Labshake search
Citations for Origene Technologies :
101 - 150 of 318 citations for 7 CHLORO 4 NITRO 5 PIPERIDINO 2 1 3 BENZOXADIAZOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 5 μg of pLenti-Envelop vector and 6 μg of packaging plasmids (OriGene Technologies, Inc. Rockville, MD) to isolate lentivirus according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... [TL51074CB 5’ –AGACCGTAAACGCTATCAGCAAGAAGTAG] are in the plasmid backbone pGFP-C-shLenti and were from Origene (Rockville, MD). The non-targeting shRNA control ...
-
bioRxiv - Genomics 2019Quote: ... Control or CGGBP1-shmiR (targeting 4 different regions in CGGBP1 ORF) or CGGBP1-overexpression lentivirus constructs were obtained from Origene. The third generation lenti-packaging plasmids ...
-
bioRxiv - Biochemistry 2021Quote: ... Expression constructs encoding Myc-Flag-tagged (C- end) mouse CNNM1-4 and ARL15 in the pCMV6-Entry expression vector were acquired from OriGene (MR218318 for CNNM1 ...
-
bioRxiv - Plant Biology 2023Quote: ... overnight at 4°C (anti-PsbA; AS05 084A; anti-PsaB; AS10 695; anti-APC; AS08 277; Agrisera, anti-His tag; TA150087; OriGene). The membrane was washed 3 times in TBST-T at room temperature for 15 minutes each wash followed by incubation with secondary polyclonal anti-rabbit antisera HRP for one hour at room temperature in TBS-T (Jackson ImmunoResearch ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HEK293-Null2 cells were also co-transfected with a human MD-2 expression clone (OriGene, RC204686). JetPRIME (Polyplus ...
-
bioRxiv - Biochemistry 2021Quote: ... the gene encoding for green fluorescent protein (GFP) and the 3’UTR of the Cpt1a gene were cloned into a unique EcoRI site of pBS31 vector (OriGene Technologies, Rockville, Maryland). This vector contains the phosphoglycerate kinase (PGK ...
-
bioRxiv - Cell Biology 2021Quote: ... Each well received 100 ng of the pMIR-REPORT™ Luciferase vector containing the 3’UTR-hTLR4 (without a negative control) in combination with 1µg pCMV-MIR or pCMV-pre-mir125b1 (OriGene Technologies, Rockville, Maryland, USA) or let7A2 generated in the laboratory and with 50 ng of pRL-TK Renilla luciferase plasmid (Promega). ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sections were then incubated overnight at 4 °C with one of the following primary antibodies: rabbit polyclonal anti-mGFP (TA150122, OriGene, USA), mouse anti-hNuclei ...
-
bioRxiv - Cancer Biology 2022Quote: Western blot antibodies for GOT2 detection were rabbit anti-human GOT-2 polyclonal antibody (Origene, catalog #TA325088) and HRP-conjugated AffiniPure Goat anti-rabbit IgG (ThermoFisher ...
-
bioRxiv - Biophysics 2022Quote: ... Msi-2 cDNA (residues 234–328, according to the alignment with Msi-1C) was purchased from OriGene. All these variants were constructed in a pET21 vector backbone with a hexa-histidine tag on the C-terminus of the expressed protein ...
-
bioRxiv - Cell Biology 2022Quote: ... ATG7-/- and Scr Caco-2 cells as discussed previously.11 Occludin ORF in pCMV6-AC-GFP (Origene) and corresponding control plasmid were used to transfect Caco-2 cells using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... 0.64 μg of pMD2G-VSVG and 0.64 μg of pspAX.2 using transfecting reagent Megatran 1.0 (Origene).
-
bioRxiv - Neuroscience 2022Quote: ... and anti-HCRTR1 from rabbit (Origene Cat#TA328918; 1:100–1:500). Donkey IgG secondary antibodies coupled to Alexa-594 ...
-
bioRxiv - Neuroscience 2020Quote: ... NDUFAF1 (1:2,000, Origene), TOM20 (1:500 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... MG87.TRKB cells were transfected with a mix of 4 AP2M specific shRNA sequences (#TG712191, Origene, USA or scrambled sequence as control) using Lipofectamine 2000 (#11668019 ...
-
bioRxiv - Cancer Biology 2023Quote: Cells expressing shMdm2 or shScramble were sorted for GFP positive cells and transduced with lentivirus carrying a pool of shRNAs against Sprouty4 (4 different shRNAs purchased from OriGene, cat.#HC108594) or shScramble sequence as control (OriGene ...
-
bioRxiv - Cancer Biology 2023Quote: ... HT1080 p53KO cells were transduced with lentivirus carrying a pool of shRNAs against Mdm2 (4 different shRNAs purchased from OriGene, cat.#TL311529) or shScramble sequence as control (OriGene ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAi was performed by transfecting cells 2 days before synchronization at 20% confluence with 5 nM siRNA (scrambled sequence, two different sequences against PARP1 and TRF1: PARP1 siRNA Origene SR300098B/C ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAi was performed by transfecting cells 2 days before synchronization at 20% confluence with 5 nM siRNA (scrambled sequence, two different sequences against PARP1 and TRF1: PARP1 siRNA Origene SR300098B/C, TRF1 siRNA Origene SR322000B/C ...
-
bioRxiv - Microbiology 2022Quote: ... Two 0.5 ml aliquots of the supernatant were then mixed with 5 μg of bead-immobilized anti-basigin (Origene TA501189) and anti-neuroplastin (R&D Systems AF7818 ...
-
bioRxiv - Neuroscience 2020Quote: ... and CALM1 Human calmodulin 1 transcript variant 1 (catalog SC115829, Origene, Rockville MD), using PCR primers to add flanking restriction sites ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... mouse anti-ZEB2 (Origene, TA802113, IF 1:150, WB 1:2000 in milk), sheep anti-TBR2 (R&D Systems ...
-
bioRxiv - Cell Biology 2020Quote: ... Overexpressed HA-NFATc3 and endogenous Trim39 were detected using anti-HA (1:500) and anti-Trim39 (from Proteintech 1:200, from Origene 1:400) antibodies respectively ...
-
bioRxiv - Cancer Biology 2020Quote: ... Stable knockdown of FTO was achieved by lentiviral delivery (5 D.O.I) of anti-FTO sh-RNA (Origene, #TL308064, sh-FTO#B). Isolation of infected cells was performed by GFP positive cells sorting on FACSAria.
-
bioRxiv - Immunology 2021Quote: ... HAP1 cells were transfected with 2 µg lentiCRISPR v2 bearing the sgRNA of interest in the presence of transfection reagent Turbofectin 8.0 (OriGene). Transfected cells were selected with 2 µg/ml puromycin (InvivoGen ...
-
bioRxiv - Cancer Biology 2019Quote: ... CRISPR/Cas9 plasmid at 2 μg concentration was transfected by Turbofectin 8.0 following the protocol from OriGene (Rockville, MD).
-
bioRxiv - Cancer Biology 2019Quote: ... Lgr5 (1:200) (Origene, TA503316), Oct4 (1:200 ...
-
bioRxiv - Cancer Biology 2021Quote: ... LHX1 (OriGene #TA504528; 1:1000); LTL-Biotinylated (Vectorlabs B-1325 ...
-
bioRxiv - Molecular Biology 2022Quote: ... tGFP (1:200 Origene, TA150041), ki67 (Medac 275R-18) ...
-
Orchestration of alternative splicing regulates bone marrow mesenchymal stem cells fate during agingbioRxiv - Cell Biology 2022Quote: ... β actin (Origene, TA811000, 1:5000), GAPDH (Origene ...
-
Orchestration of alternative splicing regulates bone marrow mesenchymal stem cells fate during agingbioRxiv - Cell Biology 2022Quote: ... GAPDH (Origene, TA802519, 1:5000), PCNA (BOSTER Biological Technology ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tff1 (OriGene, TA322883 1:100), Tff2 (Proteintech ...
-
bioRxiv - Cell Biology 2021Quote: ... Mcam (Origene, rabbit 1:1000), Mpz (AvesLab ...
-
bioRxiv - Developmental Biology 2022Quote: ... K14 (OriGene, #BP5009, 1:1000), Involucrin (Biolegend ...
-
bioRxiv - Cell Biology 2020Quote: ... tdTomato (1:200, TA180009, OriGene), HuNu (1:200 ...
-
bioRxiv - Cell Biology 2021Quote: ... Mcam (Origene, rabbit 1:200), Mpz (AvesLab ...
-
bioRxiv - Cancer Biology 2020Quote: ... ANXA11 (OriGene, 1/100 dilution), PPP1R12A (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... FOXD1 (TA322737, OriGene, 1:50) PAX8 (NBP2-29903 ...
-
bioRxiv - Developmental Biology 2022Quote: ... TRIM24 (1:1000, TA802797, Origene), TRIM33 (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... clone 4D6 (Origene, 1:1000), anti-beta-Amyloid ...
-
bioRxiv - Genomics 2023Quote: ... MSX1 (Origene, TA590129, 1:5000), PRRX1 (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-PPP3CB (Origene, 1:200); anti-GRASP65 (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... tRFP (OriGene, TA150061, 1:250), GRIA1 (Alomone ...
-
bioRxiv - Cell Biology 2024Quote: ... syntenin (OriGene, TA504796, 1:1000), annexin A1 (Abcam ...
-
bioRxiv - Cancer Biology 2024Quote: ... GAPDH (OTI2D9; 1:5,000; Origene), and Actin (JLA20 ...
-
bioRxiv - Neuroscience 2024Quote: ... SETD7(1:500, TA503322, Origene), and GAPDH (1:2,000 ...
-
bioRxiv - Immunology 2020Quote: ... paraffin-embedded serial sections (5 μm) first underwent standard deparaffinization and rehydration procedures and were then probed with GHRHR (Origene, cat # TA311715) as primary antibody ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: HEK-null2 cells were transfected with a human TLR4 expression clone (pcDNA3-TLR4-YFP was a gift from Doug Golenbock – http://n2t.net/addgene:13018) and human MD-2 expression clone (Origene; RC204686) to assess cytokine secretion in response to TLR4 agonist treatments ...
-
bioRxiv - Genetics 2022Quote: ... DAB staining was performed using Polink-2 Plus HRP Polymer and AP Polymer detection for Rb antibody kit (D39-18, Origene) following the manufacturer’s instructions ...