Labshake search
Citations for Origene Technologies :
1 - 50 of 66 citations for 7 BENZYLOXY 3 METHYL 5 NITROINDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: 5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
bioRxiv - Microbiology 2023Quote: AREG: 5’-GCACCTGGAAGCAGTAACATGC-3’ (Fwd) and 5’-GGCAGCTATGGCTGCTAATGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD3: 5’-AGGCAGTAGATGTGCGCCAGAT-3’ (Fwd) and 5’-TCCTGGATGGTGCTGTTGAGGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD1: 5’-CCTGGCTATCTATCCACCATGTG-3’ (Fwd) and 5’-TTCTGGTCCTCGTCTTGCCTGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9L: 5’-CCGCTCTACCACAATGCCATCA-3’ (Fwd) and 5’-CTGAGTTCAGGTGCATCTGGCT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: AMOTL2: 5’-AGTGAGCGACAAACAGCAGACG-3’ (Fwd) and 5’-ATCTCTGCTCCCGTGTTTGGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9: 5’-TCCAGCTCGTTCTCCCAACTTG-3’ (Fwd) and 5’-GATTGGAGTGAGAAAGTGGCTGG-3’ (Rev) (sequences from Origene)
-
bioRxiv - Microbiology 2023Quote: RPLP0: 5’-TGGTCATCCAGCAGGTGTTCGA-3’ (Fwd) and 5’-ACAGACACTGGCAACATTGCGG-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: PYGO1: 5’-GGTTAGGAGGACCAGGTGTACA-3’ (Fwd) and 5’-AGCAGCCACTAGATGGTCAGAG-3’ (Rev) (sequences from Origene)
-
bioRxiv - Neuroscience 2020Quote: ... ShRNA sequences against rat Zdhhc3 (5’-GAGACATTGAACGGAAACCAGAATACCTC-3’) and Zdhhc7 (5’-ATGACATGGCTTCTGGTCGTCTATGCAGA-3’) were purchased from Origene and subcloned ...
-
bioRxiv - Cell Biology 2019Quote: ... ShRNA sequences specific for hERG1a 5’-GCGCAGCGGCTTGCTCAACTCCACCTCGG-3’ and its control 5’-GCACTACCAGAGCTAACTCAGATAGTACT-3’ were provided by Origene into a pGFP-V-RS vector ...
-
bioRxiv - Cell Biology 2020Quote: ... siERCC8 (5′-GGAGAACAGAUAACUAUGCUUAAGG −3′) and siRNA duplex control (Origene) was diluted with DMEM to a final concentration of 20□nM ...
-
bioRxiv - Cancer Biology 2019Quote: ... shSIRT3_#4: 5’-TCACATTCTGTTGACTCTCCATACTCAGC-3’) in pRS vector (Origene, TR309432) were used to stably transfect OVCA433 cells (Supp ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A, OriGene, Rockville, MD, USA) and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B, OriGene, Rockville, MD, USA). A shRNA 29-mer scrambled shRNA was used as a negative control (TR30021V ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were generated after transfection with pRS-puro-shWRN (5′-AGGCAGGTGTAG-GAATTGAAGGAGATCAG-3′; sequence ID: TI333414 Origene) and puromycin selection (Palermo et al. ...
-
bioRxiv - Genomics 2021Quote: ... containing a single guide RNA target sequence 5’-TAGGTCGCCAAAATCCACAC-3’ or the pCas-Guide CRISPR vector (OriGene, KN519669G2) containing a single guide RNA target sequence 5’-CGAGGCGTTTGACCCACCAG-3’ or a combination of the two was transfected into the mouse submandibular salivary gland cell line SIMS using Thermo Fisher’s Lipofectamine 3000 Reagent kit in the following manner ...
-
bioRxiv - Molecular Biology 2022Quote: A 1.6-kb full length human PAX9 cDNA clone (GeneBank™, accession number NM_006194.1) containing 5’ and 3’ UTRs was purchased from OriGene Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... The different fragments were PCR amplified using custom designed primers representing the 5’ and 3’ sequence respectively with Tau cDNA (RC213312, Origene) as template ...
-
bioRxiv - Cell Biology 2021Quote: ... the small hairpin (shRNA)-expressing vectors pSUPER.neo (R4-1) (Fleig et al., 2012) and a pRS vector-based construct targeting 5’- ATGAGGAGACAGCGGCTTCACAGATTCGA-3’ (R4-2) (OriGene) were used ...
-
bioRxiv - Genomics 2021Quote: ... it was determined that the greatest knockout efficiency had been achieved using the pCas-Guide CRISPR vector with guide RNA sequence of 5’-TAGGTCGCCAAAATCCACAC-3’ (OriGene, KN519669G1). These cells were chosen to produce individual clones using standard single cell cloning techniques in 96-well plates.
-
bioRxiv - Cancer Biology 2022Quote: ... the 3’UTR of FOXP2 was generated from the FOXP2 3’UTR plasmid (Origene, #SC212500, NM_014491) by PCR ...
-
bioRxiv - Bioengineering 2023Quote: ... and MDR1-*3 obtained from OriGene Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... Recombinant pure human 14-3-3σ (Origene) or mutations [12] (0.5 µg) ...
-
bioRxiv - Biochemistry 2023Quote: The human spastin and mGFP-spastin constructs were cloned using the sequence corresponding to isoform 3 (UniProtKB reference sequence Q9UBP0-3; OriGene), a shortened variant derived from use of an alternative start residue (Met-87) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and (OriGene, CAT #TA-50011-3, 1:2000) with donkey anti-rabbit HRP and sheep anti-mouse HRP secondaries (1:10000).
-
bioRxiv - Bioengineering 2024Quote: ... and incubated with 5 μg/ml anti-human FcγRIIa (Origene, clone OTI9G5; 5 μg/ml) in blocking solution at 4°C overnight ...
-
bioRxiv - Molecular Biology 2019Quote: ... cells were transfected with 3 μL of Turbofectin 8.0 (Origene) and 1,000 ng of total DNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... The full length MAFG 3’UTR sequence (NM_002359.3 OriGene, USA) was a gift from I ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 x 106 iPSNs were nucleofected with 5 μg of antibody and 4 μg Trim21 GFP plasmid DNA (Origene) with Lonza P3 Primary Cell 4D Nucleofector Kit (Lonza ...
-
bioRxiv - Physiology 2021Quote: ... medium was replaced by serum-free OptiMEM and cells were transfected with Septin-7-specific shRNA constructs in retroviral pGFP-V-RS vectors (Origene, Cambridge, UK) using Lipofectamine 2000 transfection reagent ...
-
bioRxiv - Microbiology 2021Quote: RNA interference for ATG5 and ATG7 in HepG2 cells was performed according to the protocol of ATG5/7 Human shRNA Plasmid Kits (Origene, Rockville, MD, USA). HepG2 cells (1 × 106 ...
-
bioRxiv - Cancer Biology 2021Quote: ... RAW 264.7 cells were treated with 5 ng/ml murine recombinant IL-18 protein or 5 ng/mL murine recombinant IL-20 protein (Origene, Rockville, MD, USA) for 72 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... Galectin-3-binding protein ORF was subcloned from its source vector (Origene # RC204918) into bicistronic lentiviral transfer vector pHR-CMV-TetO2 3C-TwinStrep-IRES-EmGFP vector (Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mutant PES1 (#CW306514) and POLR2K (#CW306515) 3’UTR clones were all purchased from Origene. Mutant 3’UTR plasmids were generated by synthesizing 3’ UTR sequences in which the three GCCCCC seed matches in the 3’ UTR of PES1 and one in 3’ UTR of POLR2K was each changed to TGCAAA and this altered sequence was each inserted into the pmiRTarget construct by Origene ...
-
bioRxiv - Cancer Biology 2021Quote: ... with 3 @g of either pCMV-6-Entry vector (OriGene, cat# PS100001, Rockville, MD) or pCMV-6-Entry expressing the CKB TrueORF (cat#RC203669) ...
-
bioRxiv - Biochemistry 2023Quote: ... About 5 x 106 HEK-293T cells were transfected with 5 µg of the plasmid pCMV6-XL5 HSD2 (SC122552, OriGene Technologies, Inc., Rockville, MD, USA) using the Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... hippocampal neurons were treated at DIV 3 with AAV1mCherry-pU6-Kv2.1 shRNA designed by OriGene (target sequence ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 μl Lipofectamine 2000 was mixed with 1 μg of each HA-ZNF804A (Origene, RG211363) or Myc-NT5C2 (Origene ...
-
bioRxiv - Developmental Biology 2023Quote: ... Antibodies used are as follows: for immunoprecipitation (OriGene, CAT #TA-50011-3 and Origene, #TA150041); for western blot ...
-
bioRxiv - Microbiology 2020Quote: CD4+ 293T cells were transfected with 25 pmol of pooled siRNA (Origene, 3 siRNA per pool) with RNAiMax twice (on day 1 and 3) ...
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 CIC OE cells were developed using CIC-Myc-tag plasmid purchased from Origene (CAT#: RC215209). Geneticin (250μg/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-cleaved Caspase-3 (9661S, CST, 1:500) and anti-Flag (TA-50011-100; Origene, 1:500). Cells were washed with PBS and incubated with secondary antibodies (Jackson Immunoresearch Laboratories ...
-
bioRxiv - Immunology 2023Quote: The plasmid expressing myc-DDK-tagged wild-type ADA2 (transcript variant 3, NM_001282225) was purchased from OriGene Technologies (#RC238645) ...
-
bioRxiv - Genomics 2019Quote: ... For the 5’ eQTL a 250 bp construct containing the rs17168486 SNP (Origene) was subcloned into the Firefly luciferase reporter vector pGL4.23 (Promega ...
-
bioRxiv - Cancer Biology 2021Quote: ... Increasing concentrations (0, 2.5, 5 and 10 nM) of scrambled (scr, OriGene, SR30004) or ABCE1 siRNAs diluted in OptiMEM (Thermofisher ...
-
bioRxiv - Cell Biology 2022Quote: ... 3×106 HEK293T cells were transfected with pLKO_1 (encoding sh_RNAi) or pCMV6-AC (Origene #RG217766, encoding GFP-UHRF1) lentiviral plasmids ...
-
bioRxiv - Microbiology 2024Quote: ... The cleared medium was supplemented with 1:5 Lenti Concentrator (OriGene, Rockville, MD, USA) and incubated 2-4 hours at 4°C ...
-
bioRxiv - Physiology 2019Quote: ... NRVMs (1 – 3 days post isolation) were transiently transfected with either variant 8 of human BIN1 (AmpII) (Origene Inc, USA) cloned into pCMV6-AC-mKate2 entry vector (Origene Inc ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a human GAB1 3′-UTR reporter plasmid (containing 3770 bp immediately downstream of the end of the GAB1 ORF cloned into pMirTarget, Origene), a control Renilla luciferase plasmid (Promega ...