Labshake search
Citations for Origene Technologies :
151 - 200 of 420 citations for 7 7 4 4 Bipiperidine 1 1 diyldi 2 1 ethanediyl bis 10 methoxy 7H pyrido 4 3 c carbazole tetramethanesulfonate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies used were hnRNPM (Origene technologies, TA301557, 1:50,000), GAPDH (EMD Millipore ...
-
bioRxiv - Cancer Biology 2023Quote: ... The TGF beta 1 (NM_000660) Human Untagged Clone (Origene, SC119746) was used to perform site-directed mutagenesis on residues C355 ...
-
bioRxiv - Pathology 2024Quote: ... The coding sequence for Gremlin-1 (Origene, Cat-No RC210835) was inserted into the plasmid pWPI (kindly provided by Roy Bicknell at University of Birmingham) ...
-
bioRxiv - Biochemistry 2024Quote: ... and mouse α-PUS7 monoclonal antibody (OriGene, OTI4C6; 1:1,000) followed by goat α-rabbit ...
-
bioRxiv - Cell Biology 2024Quote: ... and mouse anti-BTN3A2 antibodies (ORIGENE, USA, #CF500730, 1:50), respectively ...
-
bioRxiv - Cancer Biology 2020Quote: ... was purchased from Sigma Aldrich and mouse anti-PDLIM2 Ab (1:250) was purchased from Origene. Rabbit anti-FAK Abs (1:500) ...
-
bioRxiv - Immunology 2021Quote: NLRP1 and CARD8 transcript variant 1 DNA obtained commercially from Origene (pCMV6-entry clones RC216481 and RC230245 ...
-
bioRxiv - Genetics 2023Quote: ... SMCs were stained with anti-ZC3HC1 (Origene, AP20366PU-N, 1:100), anti-Tubulin (abcam ...
-
bioRxiv - Neuroscience 2024Quote: ... with mouse monoclonal anti-FLAG antibody (anti-DDK; 1:1,000, OriGene) in blocking solution for 2–3 days ...
-
bioRxiv - Neuroscience 2021Quote: ... In experiments where Neuro2A cells were stained for recombinases (Cre 1:500, EMD Millipore cat# MAB3120; Flp 1:500, Origene cat# TA160030; Figures 1B, 2B, S1, S2) the protocol was as described above ...
-
bioRxiv - Molecular Biology 2022Quote: ... wells were blocked with 1% BSA diluted in PBS for 30 min at 37 °C and increasing amounts (0 μg to 3 μg) of PLG (Origene) diluted in blocking solution were added to the wells and incubated for 1 hour at 37 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mM DTT and 0.25 µg recombinant SLP-76 (OriGene, Cat. TP721201) were then added to the sample and incubated at 30 °C for 60 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mouse monoclonal anti-ZsGreen1 (ZSG) clone TI2C2 (1:2000) (OriGene, Cat#: TA180002); Mouse anti-capsid (1:3000 ...
-
bioRxiv - Cell Biology 2020Quote: Mouse Add1 cDNA transcript variant 1 was purchased from Origene (Cat# MR210357). The Add1 gene was amplified and subcloned into pUC19 for point mutations by the GeneArt Site-Directed Mutagenesis Plus Kit (Life Technologies ...
-
bioRxiv - Immunology 2022Quote: ... 1 μl from a 200 ng/μl stock of NEU1 (TP300386; Origene), NEU2 (TP319858 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The primary antibodies used were: rabbit anti-GFP (1:500; Origene TP401), mouse anti-GFP (1:500 ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant human glutaredoxin (Grx) transcript variant 1 was from Origene (cat# TP319385) (Rockville ...
-
bioRxiv - Developmental Biology 2019Quote: ... The primary antibody anti-DDK (FLAG®) (OriGene Technologies, TA50011, 1:1000) was used for detection of proteins overexpressed from the pCMV6-entry vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... The following primary antibodies were incubated overnight: TRIM24 (1:200, TA802797, Origene), TRIM33 (1:200 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse monoclonal antibody against IL-1β (Origene Inc., Cat# TA506443, 1:1000), rabbit polyclonal antibody against p65 (Abcam ...
-
bioRxiv - Immunology 2022Quote: ... Human MR1 transcript variant 1 (NM_001531) cDNA clone was purchased from Origene. The constructs were then cloned into a lentiviral expression vector with a multiple cloning site separated from GFP reporter via an Internal Ribosomal Entry Site (IRES).
-
bioRxiv - Molecular Biology 2023Quote: ... and mouse TMEM87A -transcript variant 1 (NM_173734; MC201598) were purchased from Origene. The coding sequences of these genes were PCR amplified and then subcloned into CMV-pIRES2-DsRed/iRFP vector using the SalI/BamHI restriction enzyme sites or CMV-EGFP-N1 vector using the EcoRI/AgeI restriction enzyme sites using the cloning kit (EZ-Fusion™ HT Cloning core Kit ...
-
bioRxiv - Immunology 2023Quote: ... and mouse anti-GAPDH monoclonal IgG (Origene TA802519, clone OTI2D9, 1:2000). Secondary antibodies were donkey anti-rabbit IgG (Alexa Fluor 790 ...
-
bioRxiv - Neuroscience 2023Quote: ... KCNK3 (Myc-DDK-tagged) (TASK-1) (NM_002246.3) was purchased from OriGene (RC215155) and cloned into IRES2 vector using BglII/XhoI sites ...
-
bioRxiv - Immunology 2023Quote: ... anti-DDK (FLAG) (clone OTI4C5, #TA50011, 1:1000; OriGene Technologies; RRID: AB_2622345), anti-LC3B (#ab51520 ...
-
bioRxiv - Neuroscience 2024Quote: ... or a dilution of 1/1,000 anti-turboGFP chicken antibody (Origene; TA150075) respectively ...
-
bioRxiv - Bioengineering 2024Quote: ... Primary antibodies pan cytokeratin (PanCK, 1:100, OriGene Catalog # CF190032, Lot # F003) and vimentin (VIM ...
-
bioRxiv - Cell Biology 2020Quote: ... or α-CD68 (1:2000, mouse monoclonal, clone BM4000, OriGene Technologies, Rockville, USA). An α-mouse ...
-
bioRxiv - Cell Biology 2019Quote: The following primary antibodies were used: Goat anti-GFP (Origene; R1091P; 1:200), rabbit polyclonal anti-keratin 5 (BioLegend ...
-
bioRxiv - Cell Biology 2021Quote: ... The following primary antibodies were used: anti-mCherry (AB0040-200, Origene, 1:500), anti-myc 9E10 (13-2500 ...
-
bioRxiv - Neuroscience 2021Quote: ... and guinea pig anti-Drebrin polyclonal antibody (1:100, OriGene Technologies, Herford, Germany). Neural dendrites were detected with the neurofilament marker anti-SMI 311 mouse monoclonal antibody (1:600 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and stained with 1:2000 HRP-conjugated anti-human ACE2 (clone OTI1D2, Origene) or 1:5000 HRP-conjugated donkey anti-human IgG (Jackson Immuno Research ...
-
bioRxiv - Neuroscience 2023Quote: ... and then incubated with goat anti-tdTomato antibody (1:300, Origene, # AB8181-200), rabbit anti-St8sia1 (GD3S ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibodies used: YFP Goat polyclonal antibody (1:500) (ORIGENE, Cat.No. AB1166-100), mouse mCherry antibody (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... and anti-LGR5 mouse monoclonal conjugated with PE at 1:100 (Origene #TA400001). Apart from the LGR5 antibody incubation (of 20 minutes) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary monoclonal antibodies included mouse anti-human ACE2 (1:1500) (Origene, Rockland, Maryland), rabbit anti-human (1:1000 ...
-
Pluripotent stem cell SOX9 and INS reporters facilitate differentiation into insulin-producing cellsbioRxiv - Developmental Biology 2021Quote: ... The membrane was incubated with anti-CPA1 (1:1000, Origene, cat# TA500053, clone OTI2A3) overnight at 4°C then washed and followed by incubation with the peroxidase-labeled secondary antibody for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... FLAG-tagged MtTop1 was detected with anti-DDK (FLAG) antibodies (Origene, TA50011, 1:2,500). Membranes were incubated with primary antibodies at room temperature for 3 hr ...
-
bioRxiv - Cell Biology 2021Quote: ... Antibodies or reagents used were: (i) CD235a-PE (1:2500 dilution; OriGene cat#DM066R), CD49d-BV421 (1:100 dilution ...
-
bioRxiv - Bioengineering 2022Quote: ... Antibodies or reagents used were: (i) CD235a-PE (1:2500 dilution; OriGene cat#DM066R), CD49d-BV421 (1:100 dilution ...
-
bioRxiv - Immunology 2022Quote: ... Human MR1 transcript variant 1 (NM_001531) cDNA clone was purchased from Origene (Rockville, MD). The constructs were then cloned into a lentiviral expression vector with a multiple cloning site separated from GFP reporter via an Internal Ribosomal Entry Site (IRES ...
-
bioRxiv - Cancer Biology 2019Quote: ... KDELR3 transcript variant 1 (NM_006855) Human Myc-DDK-tagged ORF Clone (Origene, CAT#: RC201571), pCMV6-Entry Tagged Cloning mammalian vector with C-terminal Myc-DDK Tag (Origene ...
-
Mck1 defines a key S-phase checkpoint effector in response to various degrees of replication threatsbioRxiv - Molecular Biology 2019Quote: ... Hug1-13MYC protein levels were detected with mouse anti-MYC antibody (1:1000, ORIGENE) and HRP-conjugated anti-mouse IgG as the secondary antibody (1:10000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1×104 cells were mixed with mock or Igfbp2 lentivirus (catalog # MR204287L3V; OriGene Technologies) at MOI=80 in the 500 ml of 10 µg/ml polybrene/DMEM-F12 ...
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibodies were used: goat anti-mCherry (Origene, AB0040-200, 1:500), mouse anti-His (Dianova ...
-
bioRxiv - Genomics 2024Quote: ... a plasmid containing the sequences for NY-ESO-1 (CTAG1B) was ordered from OriGene Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... The cleared medium was supplemented with 1:5 Lenti Concentrator (OriGene, Rockville, MD, USA) and incubated 2-4 hours at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... ATAGAGCGTGCGGATAATGACAAGGAGTA), Synaptojanin 2 shRNA in pRFP-C-RS vector (cat. no. FI732825, TGTGCCTCTGCGGCAGCACCAGGTGAACT and FI732826, TTGTGGAGACAGAGCAGGCGATTTACATG) were purchased from Origene. Constructs of the following proteins were kind gifts ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse monoclonal antibody directed against α1-actinin (#TA500072S, IF dilution 1:100) was from Origene. Phalloidin-Alexa488 ...
-
bioRxiv - Genomics 2021Quote: ... and polyclonal anti-rabbit IgG-HRP raised in goat (R1364HRP, 1:5,000; OriGene, Herford, Germany)