Labshake search
Citations for Origene Technologies :
1 - 50 of 76 citations for 7α 12α Dihydroxycholest 4 en 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... shSIRT3_#4: 5’-TCACATTCTGTTGACTCTCCATACTCAGC-3’) in pRS vector (Origene, TR309432) were used to stably transfect OVCA433 cells (Supp ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sections were then incubated overnight at 4 °C with one of the following primary antibodies: rabbit polyclonal anti-mGFP (TA150122, OriGene, USA), mouse anti-hNuclei ...
-
bioRxiv - Neuroscience 2023Quote: 5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
bioRxiv - Microbiology 2023Quote: AREG: 5’-GCACCTGGAAGCAGTAACATGC-3’ (Fwd) and 5’-GGCAGCTATGGCTGCTAATGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD3: 5’-AGGCAGTAGATGTGCGCCAGAT-3’ (Fwd) and 5’-TCCTGGATGGTGCTGTTGAGGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD1: 5’-CCTGGCTATCTATCCACCATGTG-3’ (Fwd) and 5’-TTCTGGTCCTCGTCTTGCCTGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9L: 5’-CCGCTCTACCACAATGCCATCA-3’ (Fwd) and 5’-CTGAGTTCAGGTGCATCTGGCT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: AMOTL2: 5’-AGTGAGCGACAAACAGCAGACG-3’ (Fwd) and 5’-ATCTCTGCTCCCGTGTTTGGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9: 5’-TCCAGCTCGTTCTCCCAACTTG-3’ (Fwd) and 5’-GATTGGAGTGAGAAAGTGGCTGG-3’ (Rev) (sequences from Origene)
-
bioRxiv - Microbiology 2023Quote: RPLP0: 5’-TGGTCATCCAGCAGGTGTTCGA-3’ (Fwd) and 5’-ACAGACACTGGCAACATTGCGG-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: PYGO1: 5’-GGTTAGGAGGACCAGGTGTACA-3’ (Fwd) and 5’-AGCAGCCACTAGATGGTCAGAG-3’ (Rev) (sequences from Origene)
-
bioRxiv - Biochemistry 2023Quote: ... two gRNA vectors and one linear donor were obtained from OriGene Technologies (KN405837) ...
-
bioRxiv - Neuroscience 2020Quote: ... tdTomato 4 μM (OriGene); Oregon Green 488 BAPTA-1 hexapotassium salt 45 μM (Invitrogen) ...
-
bioRxiv - Cell Biology 2023Quote: ... WIPI-4-TurboGFP (Origene; WDR45-tGFP transcript variant 1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... the 3’UTR of FOXP2 was generated from the FOXP2 3’UTR plasmid (Origene, #SC212500, NM_014491) by PCR ...
-
bioRxiv - Cancer Biology 2019Quote: One μg of a plasmid containing TCF4 cDNA (Origene, Cat# 2243345, Rockville, MD) was transfected into indicated prostate cancer cell lines on a 6-well plate ...
-
bioRxiv - Bioengineering 2023Quote: ... and MDR1-*3 obtained from OriGene Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... ShRNA sequences against rat Zdhhc3 (5’-GAGACATTGAACGGAAACCAGAATACCTC-3’) and Zdhhc7 (5’-ATGACATGGCTTCTGGTCGTCTATGCAGA-3’) were purchased from Origene and subcloned ...
-
bioRxiv - Cell Biology 2019Quote: ... ShRNA sequences specific for hERG1a 5’-GCGCAGCGGCTTGCTCAACTCCACCTCGG-3’ and its control 5’-GCACTACCAGAGCTAACTCAGATAGTACT-3’ were provided by Origene into a pGFP-V-RS vector ...
-
bioRxiv - Biochemistry 2023Quote: ... Recombinant pure human 14-3-3σ (Origene) or mutations [12] (0.5 µg) ...
-
bioRxiv - Biochemistry 2023Quote: The human spastin and mGFP-spastin constructs were cloned using the sequence corresponding to isoform 3 (UniProtKB reference sequence Q9UBP0-3; OriGene), a shortened variant derived from use of an alternative start residue (Met-87) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and (OriGene, CAT #TA-50011-3, 1:2000) with donkey anti-rabbit HRP and sheep anti-mouse HRP secondaries (1:10000).
-
bioRxiv - Cell Biology 2020Quote: ... siERCC8 (5′-GGAGAACAGAUAACUAUGCUUAAGG −3′) and siRNA duplex control (Origene) was diluted with DMEM to a final concentration of 20□nM ...
-
bioRxiv - Molecular Biology 2019Quote: ... cells were transfected with 3 μL of Turbofectin 8.0 (Origene) and 1,000 ng of total DNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... The full length MAFG 3’UTR sequence (NM_002359.3 OriGene, USA) was a gift from I ...
-
bioRxiv - Neuroscience 2019Quote: Four shRNAs against Mus musculus Cyp19a1 and one control scrambled shRNA were obtained from Origene (Rockville; Cat No. TG509276). These plasmids express both shRNA under the control of the U6 promoter and turboGFP under the control of a CMV promoter ...
-
bioRxiv - Cancer Biology 2023Quote: ... Galectin-3-binding protein ORF was subcloned from its source vector (Origene # RC204918) into bicistronic lentiviral transfer vector pHR-CMV-TetO2 3C-TwinStrep-IRES-EmGFP vector (Addgene ...
-
bioRxiv - Microbiology 2020Quote: ... and dipeptidyl peptidase-4 (DPP4) cDNA clones were obtained from Origene, and cloned into a pcDNA3 vector (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mutant PES1 (#CW306514) and POLR2K (#CW306515) 3’UTR clones were all purchased from Origene. Mutant 3’UTR plasmids were generated by synthesizing 3’ UTR sequences in which the three GCCCCC seed matches in the 3’ UTR of PES1 and one in 3’ UTR of POLR2K was each changed to TGCAAA and this altered sequence was each inserted into the pmiRTarget construct by Origene ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A, OriGene, Rockville, MD, USA) and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B ...
-
bioRxiv - Cancer Biology 2021Quote: ... with 3 @g of either pCMV-6-Entry vector (OriGene, cat# PS100001, Rockville, MD) or pCMV-6-Entry expressing the CKB TrueORF (cat#RC203669) ...
-
bioRxiv - Microbiology 2022Quote: ... were coated with various concentrations of purified recombinant caspase-4 (Origene, TP760359) overnight at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... hippocampal neurons were treated at DIV 3 with AAV1mCherry-pU6-Kv2.1 shRNA designed by OriGene (target sequence ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B, OriGene, Rockville, MD, USA). A shRNA 29-mer scrambled shRNA was used as a negative control (TR30021V ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 μl Lipofectamine 2000 was mixed with 1 μg of each HA-ZNF804A (Origene, RG211363) or Myc-NT5C2 (Origene ...
-
bioRxiv - Developmental Biology 2023Quote: ... Antibodies used are as follows: for immunoprecipitation (OriGene, CAT #TA-50011-3 and Origene, #TA150041); for western blot ...
-
bioRxiv - Biochemistry 2021Quote: ... Plasmids containing human TIM-1 and human TIM-4 were obtained from Origene. For expression of extracellular regions ...
-
bioRxiv - Genetics 2020Quote: ... 10 μg of plasmid DNA (4 variants of shRNA carrying plasmids, OriGene TL501619) DNA was used to transfect one plate ...
-
bioRxiv - Cancer Biology 2023Quote: ... Coverslips were then incubated overnight at 4 °C with EWS (Origene, 1:200) and pH2AX (CST ...
-
bioRxiv - Microbiology 2020Quote: CD4+ 293T cells were transfected with 25 pmol of pooled siRNA (Origene, 3 siRNA per pool) with RNAiMax twice (on day 1 and 3) ...
-
bioRxiv - Genomics 2021Quote: ... Samples were incubated 1h at 4°C with anti-MYC magnetic beads (TA150044, Origene). Beads were washed 5 times with lysis buffer without inhibitors ...
-
bioRxiv - Cell Biology 2020Quote: ... then fixed with 4% PFA and stained with 1:5000 rabbit anti-EGFP (Origene) and anti-rabbit AF647 (10μg/ml ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were transduced with a set of 4 shRNAs against Spry4 (OriGene, cat.#HC108594) or shRNA negative control (OriGene ...
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 CIC OE cells were developed using CIC-Myc-tag plasmid purchased from Origene (CAT#: RC215209). Geneticin (250μg/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-cleaved Caspase-3 (9661S, CST, 1:500) and anti-Flag (TA-50011-100; Origene, 1:500). Cells were washed with PBS and incubated with secondary antibodies (Jackson Immunoresearch Laboratories ...
-
bioRxiv - Immunology 2023Quote: The plasmid expressing myc-DDK-tagged wild-type ADA2 (transcript variant 3, NM_001282225) was purchased from OriGene Technologies (#RC238645) ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were generated after transfection with pRS-puro-shWRN (5′-AGGCAGGTGTAG-GAATTGAAGGAGATCAG-3′; sequence ID: TI333414 Origene) and puromycin selection (Palermo et al. ...
-
bioRxiv - Genomics 2021Quote: ... containing a single guide RNA target sequence 5’-TAGGTCGCCAAAATCCACAC-3’ or the pCas-Guide CRISPR vector (OriGene, KN519669G2) containing a single guide RNA target sequence 5’-CGAGGCGTTTGACCCACCAG-3’ or a combination of the two was transfected into the mouse submandibular salivary gland cell line SIMS using Thermo Fisher’s Lipofectamine 3000 Reagent kit in the following manner ...
-
bioRxiv - Cell Biology 2022Quote: ... 3×106 HEK293T cells were transfected with pLKO_1 (encoding sh_RNAi) or pCMV6-AC (Origene #RG217766, encoding GFP-UHRF1) lentiviral plasmids ...
-
bioRxiv - Molecular Biology 2022Quote: A 1.6-kb full length human PAX9 cDNA clone (GeneBank™, accession number NM_006194.1) containing 5’ and 3’ UTRs was purchased from OriGene Technologies ...