Labshake search
Citations for Origene Technologies :
51 - 100 of 316 citations for 6 ethoxy 1 2 3 4 tetrahydro 2 2 4 trimethylquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... The membranes were incubated with the following primary antibodies overnight at 4°C: mouse anti-DPP9 (Origene, TA503937, 1:1000). After three washes with TBST ...
-
bioRxiv - Neuroscience 2020Quote: CaMKIIα and calmodulin expression in Drosophila cells was accomplished as follows: CaMKIIα and calmodulin coding sequences were copied from human cDNA clones CAMK2A transcript variant 2 (catalog SC109000, Origene, Rockville MD) and CALM1 Human calmodulin 1 transcript variant 1 (catalog SC115829 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Nrf2 was knocked-down by RNA interference (RNAi) using the following 19-bp (including a 2-deoxynucleotide overhang) siRNAs (Origene, Beijing, China): Nrf2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... staining was performed using Polink-2 Plus HRP Polymer and AP Polymer detection for Rb antibody kit (D39-18, Origene, Washington, USA) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... were coated with various concentrations of purified recombinant caspase-4 (Origene, TP760359) overnight at 4°C ...
-
bioRxiv - Genetics 2020Quote: ... 10 μg of plasmid DNA (4 variants of shRNA carrying plasmids, OriGene TL501619) DNA was used to transfect one plate ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated overnight at 4 °C using a rabbit polyclonal anti-GLP-1R antibody (1:50; Origene, Rockville, MD, USA, TA336864). Specificity of GLP-1R antiserum has been previously described in detail [21–23] ...
-
bioRxiv - Genomics 2021Quote: ... Samples were incubated 1h at 4°C with anti-MYC magnetic beads (TA150044, Origene). Beads were washed 5 times with lysis buffer without inhibitors ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were transduced with a set of 4 shRNAs against Spry4 (OriGene, cat.#HC108594) or shRNA negative control (OriGene ...
-
bioRxiv - Developmental Biology 2023Quote: ... and (OriGene, CAT #TA-50011-3, 1:2000) with donkey anti-rabbit HRP and sheep anti-mouse HRP secondaries (1:10000).
-
bioRxiv - Cell Biology 2021Quote: ... primary antibody was applied overnight at 4 °C including antibodies against β-catenin (cat# AB0095-200, OriGene), β-Actin (cat# 4967 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stable cell lines were stablished transducing cells with a set of 4 shRNAs against Mdm2 (Origene, cat.#TL311529) or shRNA negative control (Origene ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 x 106 iPSNs were nucleofected with 5 μg of antibody and 4 μg Trim21 GFP plasmid DNA (Origene) with Lonza P3 Primary Cell 4D Nucleofector Kit (Lonza ...
-
bioRxiv - Cancer Biology 2019Quote: Replication incompetent lentivirus were produced in HEK 293T cells co-transfected by mixing 5 µg of either pLKO.1 Empty Vector or pLKO.1 shRNA targeting SMARCD3 with 6 µg Lenti-vpak packaging kit components (OriGene) and 33 µL of transfection reagent (OriGene ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-cleaved Caspase-3 (9661S, CST, 1:500) and anti-Flag (TA-50011-100; Origene, 1:500). Cells were washed with PBS and incubated with secondary antibodies (Jackson Immunoresearch Laboratories ...
-
bioRxiv - Genomics 2019Quote: ... Control or CGGBP1-shmiR (targeting 4 different regions in CGGBP1 ORF) or CGGBP1-overexpression lentivirus constructs were obtained from Origene. The third generation lenti-packaging plasmids ...
-
bioRxiv - Biochemistry 2021Quote: ... Expression constructs encoding Myc-Flag-tagged (C- end) mouse CNNM1-4 and ARL15 in the pCMV6-Entry expression vector were acquired from OriGene (MR218318 for CNNM1 ...
-
bioRxiv - Plant Biology 2023Quote: ... overnight at 4°C (anti-PsbA; AS05 084A; anti-PsaB; AS10 695; anti-APC; AS08 277; Agrisera, anti-His tag; TA150087; OriGene). The membrane was washed 3 times in TBST-T at room temperature for 15 minutes each wash followed by incubation with secondary polyclonal anti-rabbit antisera HRP for one hour at room temperature in TBS-T (Jackson ImmunoResearch ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sections were then incubated overnight at 4 °C with one of the following primary antibodies: rabbit polyclonal anti-mGFP (TA150122, OriGene, USA), mouse anti-hNuclei ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... MG87.TRKB cells were transfected with a mix of 4 AP2M specific shRNA sequences (#TG712191, Origene, USA or scrambled sequence as control) using Lipofectamine 2000 (#11668019 ...
-
bioRxiv - Cancer Biology 2023Quote: Cells expressing shMdm2 or shScramble were sorted for GFP positive cells and transduced with lentivirus carrying a pool of shRNAs against Sprouty4 (4 different shRNAs purchased from OriGene, cat.#HC108594) or shScramble sequence as control (OriGene ...
-
bioRxiv - Cancer Biology 2023Quote: ... HT1080 p53KO cells were transduced with lentivirus carrying a pool of shRNAs against Mdm2 (4 different shRNAs purchased from OriGene, cat.#TL311529) or shScramble sequence as control (OriGene ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 μl Lipofectamine 2000 was mixed with 1 μg of each HA-ZNF804A (Origene, RG211363) or Myc-NT5C2 (Origene ...
-
bioRxiv - Neuroscience 2023Quote: 5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
bioRxiv - Microbiology 2023Quote: AREG: 5’-GCACCTGGAAGCAGTAACATGC-3’ (Fwd) and 5’-GGCAGCTATGGCTGCTAATGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD3: 5’-AGGCAGTAGATGTGCGCCAGAT-3’ (Fwd) and 5’-TCCTGGATGGTGCTGTTGAGGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD1: 5’-CCTGGCTATCTATCCACCATGTG-3’ (Fwd) and 5’-TTCTGGTCCTCGTCTTGCCTGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9L: 5’-CCGCTCTACCACAATGCCATCA-3’ (Fwd) and 5’-CTGAGTTCAGGTGCATCTGGCT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: AMOTL2: 5’-AGTGAGCGACAAACAGCAGACG-3’ (Fwd) and 5’-ATCTCTGCTCCCGTGTTTGGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9: 5’-TCCAGCTCGTTCTCCCAACTTG-3’ (Fwd) and 5’-GATTGGAGTGAGAAAGTGGCTGG-3’ (Rev) (sequences from Origene)
-
bioRxiv - Microbiology 2023Quote: RPLP0: 5’-TGGTCATCCAGCAGGTGTTCGA-3’ (Fwd) and 5’-ACAGACACTGGCAACATTGCGG-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: PYGO1: 5’-GGTTAGGAGGACCAGGTGTACA-3’ (Fwd) and 5’-AGCAGCCACTAGATGGTCAGAG-3’ (Rev) (sequences from Origene)
-
bioRxiv - Cancer Biology 2022Quote: ... the 3’UTR of FOXP2 was generated from the FOXP2 3’UTR plasmid (Origene, #SC212500, NM_014491) by PCR ...
-
bioRxiv - Bioengineering 2023Quote: ... and MDR1-*3 obtained from OriGene Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... ShRNA sequences against rat Zdhhc3 (5’-GAGACATTGAACGGAAACCAGAATACCTC-3’) and Zdhhc7 (5’-ATGACATGGCTTCTGGTCGTCTATGCAGA-3’) were purchased from Origene and subcloned ...
-
bioRxiv - Physiology 2019Quote: ... NRVMs (1 – 3 days post isolation) were transiently transfected with either variant 8 of human BIN1 (AmpII) (Origene Inc, USA) cloned into pCMV6-AC-mKate2 entry vector (Origene Inc ...
-
bioRxiv - Cell Biology 2019Quote: ... ShRNA sequences specific for hERG1a 5’-GCGCAGCGGCTTGCTCAACTCCACCTCGG-3’ and its control 5’-GCACTACCAGAGCTAACTCAGATAGTACT-3’ were provided by Origene into a pGFP-V-RS vector ...
-
bioRxiv - Biochemistry 2023Quote: ... Recombinant pure human 14-3-3σ (Origene) or mutations [12] (0.5 µg) ...
-
bioRxiv - Biochemistry 2023Quote: The human spastin and mGFP-spastin constructs were cloned using the sequence corresponding to isoform 3 (UniProtKB reference sequence Q9UBP0-3; OriGene), a shortened variant derived from use of an alternative start residue (Met-87) ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: Full-length human dystroglycan cDNA in CMV-6 plasmid was obtained from Origene and used as a template for all of the cloning ...
-
bioRxiv - Cell Biology 2020Quote: ... siERCC8 (5′-GGAGAACAGAUAACUAUGCUUAAGG −3′) and siRNA duplex control (Origene) was diluted with DMEM to a final concentration of 20□nM ...
-
bioRxiv - Molecular Biology 2019Quote: ... cells were transfected with 3 μL of Turbofectin 8.0 (Origene) and 1,000 ng of total DNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... The full length MAFG 3’UTR sequence (NM_002359.3 OriGene, USA) was a gift from I ...
-
bioRxiv - Molecular Biology 2019Quote: ... Plasmids were transfected into HAP1 cells seeded on a 6-well plate with Turbofectin (OriGene) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293T cells were seeded at a density of 1.4x105 cells per well in 6-well plates and transfected with 0.5-2.5ug of LRRC37A plasmid (Origene) or empty vector control (Origene ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μg of pLenti-Envelop vector and 6 μg of packaging plasmids (OriGene Technologies, Inc. Rockville, MD) to isolate lentivirus according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Galectin-3-binding protein ORF was subcloned from its source vector (Origene # RC204918) into bicistronic lentiviral transfer vector pHR-CMV-TetO2 3C-TwinStrep-IRES-EmGFP vector (Addgene ...
-
bioRxiv - Biochemistry 2023Quote: ... which were prepared using 10 pmol/well (of 6 well cell culture plate) Acot2 or control siRNA (Origene) and 1.5ul of Lipofectamine RNAiMAX using forward transfection ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mutant PES1 (#CW306514) and POLR2K (#CW306515) 3’UTR clones were all purchased from Origene. Mutant 3’UTR plasmids were generated by synthesizing 3’ UTR sequences in which the three GCCCCC seed matches in the 3’ UTR of PES1 and one in 3’ UTR of POLR2K was each changed to TGCAAA and this altered sequence was each inserted into the pmiRTarget construct by Origene ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A, OriGene, Rockville, MD, USA) and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B ...