Labshake search
Citations for Origene Technologies :
51 - 62 of 62 citations for 6 Nitro 1H benzimidazole 2 acetic acid ethyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... 31) and myc-FLAG-tagged Syncytin-1 and 2 expression constructs in the pCMV6 vector were purchased from Origene. pFR-Luc and pBD-NFkB (Agilent ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: HEK-null2 cells were transfected with a human TLR4 expression clone (pcDNA3-TLR4-YFP was a gift from Doug Golenbock – http://n2t.net/addgene:13018) and human MD-2 expression clone (Origene; RC204686) to assess cytokine secretion in response to TLR4 agonist treatments ...
-
bioRxiv - Cell Biology 2021Quote: ... the small hairpin (shRNA)-expressing vectors pSUPER.neo (R4-1) (Fleig et al., 2012) and a pRS vector-based construct targeting 5’- ATGAGGAGACAGCGGCTTCACAGATTCGA-3’ (R4-2) (OriGene) were used ...
-
bioRxiv - Molecular Biology 2022Quote: ... Blots were blocked for 1 hour at room temperature with 2% BSA diluted in PBST and incubated overnight at 4 °C with 25 μg/ml of PLG (Origene) diluted in blocking solution ...
-
bioRxiv - Genetics 2022Quote: ... DAB staining was performed using Polink-2 Plus HRP Polymer and AP Polymer detection for Rb antibody kit (D39-18, Origene) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... ATAGAGCGTGCGGATAATGACAAGGAGTA), Synaptojanin 2 shRNA in pRFP-C-RS vector (cat. no. FI732825, TGTGCCTCTGCGGCAGCACCAGGTGAACT and FI732826, TTGTGGAGACAGAGCAGGCGATTTACATG) were purchased from Origene. Constructs of the following proteins were kind gifts ...
-
bioRxiv - Immunology 2022Quote: ... Cells (1 × 105) were mixed with 2 μg of 100 μg/ml of murine NEU3 expression plasmid (MR223297; Origene, Rockville, MD) in 100 μl PBS (GE Lifesciences ...
-
bioRxiv - Molecular Biology 2024Quote: Trastuzumab light chains 1 and 2 were obtained by Tebubio Srl and cloned in the CD81-GFP vector (OriGene, 7268 bp), obtaining the antiHER2 construct (CD81-antiHER2-GFP ...
-
bioRxiv - Neuroscience 2020Quote: CaMKIIα and calmodulin expression in Drosophila cells was accomplished as follows: CaMKIIα and calmodulin coding sequences were copied from human cDNA clones CAMK2A transcript variant 2 (catalog SC109000, Origene, Rockville MD) and CALM1 Human calmodulin 1 transcript variant 1 (catalog SC115829 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Nrf2 was knocked-down by RNA interference (RNAi) using the following 19-bp (including a 2-deoxynucleotide overhang) siRNAs (Origene, Beijing, China): Nrf2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... staining was performed using Polink-2 Plus HRP Polymer and AP Polymer detection for Rb antibody kit (D39-18, Origene, Washington, USA) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then incubated for at least 20 hours at room temperature with a combination of the following primary antibodies in PBS-TX with 2% NGS or NDS: rabbit anti-α5 GABAA receptor subunit (1:200; TA338505, OriGene Tech., Rockville, USA), rabbit anti-α1 GABAA receptor subunit (1:300 ...