Labshake search
Citations for Origene Technologies :
1 - 50 of 319 citations for 6 Chloro 4 hydroxy 2 methyl 2H thieno 2 3 e 1 2 thiazine 3 carboxylic acid methyl ester 1 1 dioxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... the small hairpin (shRNA)-expressing vectors pSUPER.neo (R4-1) (Fleig et al., 2012) and a pRS vector-based construct targeting 5’- ATGAGGAGACAGCGGCTTCACAGATTCGA-3’ (R4-2) (OriGene) were used ...
-
bioRxiv - Developmental Biology 2023Quote: ... and (OriGene, CAT #TA-50011-3, 1:2000) with donkey anti-rabbit HRP and sheep anti-mouse HRP secondaries (1:10000).
-
bioRxiv - Neuroscience 2020Quote: ... and C and Nuak kinases 1 and 2 were purchased from OriGene Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... A primary mouse monoclonal Lysyl Hydroxylase 2 (LH2) antibody (Origene; Cat# TA803224, dilution 1:150) was used for the immunohistochemical staining.
-
bioRxiv - Cell Biology 2021Quote: ... anti-cleaved Caspase-3 (9661S, CST, 1:500) and anti-Flag (TA-50011-100; Origene, 1:500). Cells were washed with PBS and incubated with secondary antibodies (Jackson Immunoresearch Laboratories ...
-
bioRxiv - Microbiology 2021Quote: Full length human ACE-2-MycDDK in pCMV-6 entry vector (Origene, cat #RC208442) was expressed in Expi293™ cells ...
-
bioRxiv - Genetics 2020Quote: Thymidine Kinase 2 Human Untagged Clone (NM_004614) containing the cDNA for transcript variant 1 was purchased from OriGene Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... human TCEAL4 transcript variant 1) and pCMV6-TCEAL4 isoform-2 (CAT#: SC335597, NM_001300901, human TCEAL4 transcript variant 5) were both from Origene. TCEAL4 isoform-1 was cloned from pCMV6-TCEAL4-MYC-FLAG with the Gateway cloning system into pDONR223 and then into the destination vector pEGFP_GW ...
-
bioRxiv - Immunology 2019Quote: ... 31) and myc-FLAG-tagged Syncytin-1 and 2 expression constructs in the pCMV6 vector were purchased from Origene. pFR-Luc and pBD-NFkB (Agilent ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 μl Lipofectamine 2000 was mixed with 1 μg of each HA-ZNF804A (Origene, RG211363) or Myc-NT5C2 (Origene ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μg of PLG (Origene) were diluted in PBS together with 3 μg of D-Val-Leu-Lys 4-nitroanilide dihydrochloride chromogenic substrate (S-2251 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μg of PLG (Origene) were diluted in PBS together with 3 μg of S-2251 (Sigma ...
-
bioRxiv - Bioengineering 2023Quote: ... Sections were then developed using the respective Polink-2 Plus HRP with DAB kit (Origene, D87-6 Hamster D39-6 Rabbit). Sections were counterstained in Hematoxylin (EMS ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with 2 and 15 nM siRNA against Nrf-2 (Origene, USA, SR321100) and hTERT (Origene ...
-
bioRxiv - Cancer Biology 2019Quote: ... shSIRT3_#4: 5’-TCACATTCTGTTGACTCTCCATACTCAGC-3’) in pRS vector (Origene, TR309432) were used to stably transfect OVCA433 cells (Supp ...
-
bioRxiv - Immunology 2022Quote: ... Cells (1 × 105) were mixed with 2 μg of 100 μg/ml of murine NEU3 expression plasmid (MR223297; Origene, Rockville, MD) in 100 μl PBS (GE Lifesciences ...
-
bioRxiv - Molecular Biology 2024Quote: Trastuzumab light chains 1 and 2 were obtained by Tebubio Srl and cloned in the CD81-GFP vector (OriGene, 7268 bp), obtaining the antiHER2 construct (CD81-antiHER2-GFP ...
-
bioRxiv - Molecular Biology 2022Quote: ... and ELP3 siRNA 2 (OriGene#SR310519B)) or with pcDNA 4/T0 derivative plasmid expressing canonical ELP3 (pcDNA 4/T0-ELP3) ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then incubated for at least 20 hours at room temperature with a combination of the following primary antibodies in PBS-TX with 2% NGS or NDS: rabbit anti-α5 GABAA receptor subunit (1:200; TA338505, OriGene Tech., Rockville, USA), rabbit anti-α1 GABAA receptor subunit (1:300 ...
-
bioRxiv - Cancer Biology 2021Quote: ... with 3 @g of either pCMV-6-Entry vector (OriGene, cat# PS100001, Rockville, MD) or pCMV-6-Entry expressing the CKB TrueORF (cat#RC203669) ...
-
bioRxiv - Genetics 2021Quote: ... alpha 2 (IFNA2) (OriGene Technologies Inc, Atlanta, GA) (100 ng/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... TFE3 variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cancer Biology 2020Quote: ... human VDR transcript variant 2 cDNA (OriGene, RC519628) was transfected into the SKOV3 cells using Lipofectamine 2000TM (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... wells containing 2 µg of human PLG (Origene) were incubated with 3 µg of D-Val-Leu-Lys 4-nitroanilide dihydrochloride chromogenic substrate (S-2251 ...
-
bioRxiv - Physiology 2019Quote: ... NRVMs (1 – 3 days post isolation) were transiently transfected with either variant 8 of human BIN1 (AmpII) (Origene Inc, USA) cloned into pCMV6-AC-mKate2 entry vector (Origene Inc ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-desmoglein-2 mouse monoclonal (Origene, Rockville, MD, USA), anti-E-cadherin mouse monoclonal (BD ...
-
bioRxiv - Neuroscience 2020Quote: ... and mitofusin 2 (Mfn) was obtained from OriGene (SC114726). To generate MG constructs ...
-
bioRxiv - Cancer Biology 2020Quote: ... C-kit Variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cancer Biology 2019Quote: Replication incompetent lentivirus were produced in HEK 293T cells co-transfected by mixing 5 µg of either pLKO.1 Empty Vector or pLKO.1 shRNA targeting SMARCD3 with 6 µg Lenti-vpak packaging kit components (OriGene) and 33 µL of transfection reagent (OriGene ...
-
bioRxiv - Molecular Biology 2022Quote: ... Blots were blocked for 1 hour at room temperature with 2% BSA diluted in PBST and incubated overnight at 4 °C with 25 μg/ml of PLG (Origene) diluted in blocking solution ...
-
bioRxiv - Neuroscience 2023Quote: 5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
bioRxiv - Biochemistry 2021Quote: ... anti-SARS-CoV-2 Spike Protein was purchased from Origene Technologies Inc ...
-
bioRxiv - Zoology 2023Quote: ... an empty vector or human MD-2 (OriGene, cat. #RC204686) were transiently expressed ...
-
bioRxiv - Microbiology 2023Quote: AREG: 5’-GCACCTGGAAGCAGTAACATGC-3’ (Fwd) and 5’-GGCAGCTATGGCTGCTAATGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD3: 5’-AGGCAGTAGATGTGCGCCAGAT-3’ (Fwd) and 5’-TCCTGGATGGTGCTGTTGAGGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD1: 5’-CCTGGCTATCTATCCACCATGTG-3’ (Fwd) and 5’-TTCTGGTCCTCGTCTTGCCTGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9L: 5’-CCGCTCTACCACAATGCCATCA-3’ (Fwd) and 5’-CTGAGTTCAGGTGCATCTGGCT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: AMOTL2: 5’-AGTGAGCGACAAACAGCAGACG-3’ (Fwd) and 5’-ATCTCTGCTCCCGTGTTTGGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9: 5’-TCCAGCTCGTTCTCCCAACTTG-3’ (Fwd) and 5’-GATTGGAGTGAGAAAGTGGCTGG-3’ (Rev) (sequences from Origene)
-
bioRxiv - Microbiology 2023Quote: RPLP0: 5’-TGGTCATCCAGCAGGTGTTCGA-3’ (Fwd) and 5’-ACAGACACTGGCAACATTGCGG-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: PYGO1: 5’-GGTTAGGAGGACCAGGTGTACA-3’ (Fwd) and 5’-AGCAGCCACTAGATGGTCAGAG-3’ (Rev) (sequences from Origene)
-
bioRxiv - Cancer Biology 2022Quote: ... the 3’UTR of FOXP2 was generated from the FOXP2 3’UTR plasmid (Origene, #SC212500, NM_014491) by PCR ...
-
bioRxiv - Bioengineering 2023Quote: ... and MDR1-*3 obtained from OriGene Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... ShRNA sequences against rat Zdhhc3 (5’-GAGACATTGAACGGAAACCAGAATACCTC-3’) and Zdhhc7 (5’-ATGACATGGCTTCTGGTCGTCTATGCAGA-3’) were purchased from Origene and subcloned ...
-
bioRxiv - Biochemistry 2021Quote: ... Plasmids containing human TIM-1 and human TIM-4 were obtained from Origene. For expression of extracellular regions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Coverslips were then incubated overnight at 4 °C with EWS (Origene, 1:200) and pH2AX (CST ...
-
bioRxiv - Cell Biology 2019Quote: ... ShRNA sequences specific for hERG1a 5’-GCGCAGCGGCTTGCTCAACTCCACCTCGG-3’ and its control 5’-GCACTACCAGAGCTAACTCAGATAGTACT-3’ were provided by Origene into a pGFP-V-RS vector ...
-
bioRxiv - Biochemistry 2023Quote: ... Recombinant pure human 14-3-3σ (Origene) or mutations [12] (0.5 µg) ...
-
bioRxiv - Developmental Biology 2021Quote: ... cells were transduced (MOI=2) with a lentivirus constitutively expressing GFP (OriGene Tech # PS100093V). A pure GFP population was generated with puromycin selection for a few days in culture before use in experiments and cell line storage.
-
bioRxiv - Molecular Biology 2020Quote: ... China) and Native ORF cIAP-2 clone in pCMV vector was purchased from Origene, Rockville ...