Labshake search
Citations for Origene Technologies :
301 - 316 of 316 citations for 6 Chloro 1 2 3 4 tetrahydro quinoxaline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... we obtained a clone expressing full-length (residues 1-1106) untagged GLI1 in the pCMV6-XL5 vector backbone from OriGene Technologies (catalog number SC125780) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The gRNA sequence CTAGAGGAGGAGATCCCGTC (TGG) in exon 1 of ABI1 was cloned into a pCas-Guide-EF1a-GFP vector (cat. #: GE100018) from Origene Technologies (Rockville ...
-
bioRxiv - Cell Biology 2023Quote: ... Golgin-45-HA-MAO was generated by >90% of the cell population was further confirmed through flow Gibson assembly using the HA-MAO vector digested with NheI/KpnI and golgin-45 cDNA (missing its C-ter, amino acids 1 to 368) purchased from Origene.
-
bioRxiv - Cell Biology 2020Quote: ... passage 1 of pHCEnC were transfected with 10 nM anti-SLC4A11 siRNA (CCGAAAGUACCUGAAGUUAAAGAACT) or scrambled siRNA (OriGene Technologies, Rockville, MD, USA) using Lipofectamine LTX (Life Technologies ...
-
bioRxiv - Neuroscience 2019Quote: ... For each construct, 1 µg DNA (wt 2N4R tau, N167Q 2N4R tau, N368Q 2N4R tau or AEP (Origene clone no. RC200309)) was used ...
-
bioRxiv - Neuroscience 2020Quote: Neurons were transfected at 12 days in vitro (DIV) with PSD95-GFP (a kind gift from David Bredt [49] and FLAG-tagged Human SRXN-1 (purchased from Origene: RC207654) for 5 h using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Immunology 2021Quote: ... The Emory University Integrated Genomics core facility (Atlanta, GA) subcloned mouse and human Esm-1 cDNA from pCMV6 (Origene, Rockville, MD) into pT3 ...
-
bioRxiv - Cancer Biology 2019Quote: For exogenous over-expression of CD82 and KDELR3 genes the following expression plasmids were used: CD82 transcript variant 1 (NM_002231) Human Untagged Clone (Origene, CAT#: SC324395), pCMV6-AC Tagged Cloning mammalian vector with non-tagged expression (Origene ...
-
Development of immortalized rhesus macaque kidney cells supporting infection with a panel of virusesbioRxiv - Microbiology 2022Quote: ... After removing the supernatant cells were stained with a rat anti-podoplanin antibody (1:100; Origene AM01133PU-N, Rockville, MD, USA) or no antibody in a volume of 50 μl for 30 min on ice ...
-
bioRxiv - Microbiology 2024Quote: ... S1PR2 expression in J2 HIEs was detected by Western blot analysis using rabbit S1PR2 polyclonal antibody (1:500; #AP01198PU-N, OriGene Technologies). Villin was used as cell loading control and detected using 1:1000 dilution of mouse anti-villin (#sc-373997 ...
-
bioRxiv - Neuroscience 2021Quote: ... PVDF membranes were incubated with the indicated primary antibodies (anti-HA: Cell Signaling Technology, C29F4, Rabbit mAb CAT#: 3724, 1:1000; anti-FLAG: Origene, mouse monoclonal antibody ...
-
bioRxiv - Biochemistry 2020Quote: Viral vectors expressing lentiviral particles with 4 unique 29mer target-specific shRNA (A/B/C/D) to murine PRDX4 and 1 scramble control (non-specific or NS) were purchased from Origene (Rockville, MD). MIN6 cells were seeded on 48 well plates and cultured overnight in 0.3 mL medium ...
-
bioRxiv - Cell Biology 2023Quote: ... DSG2 and DSG3-Fc proteins and N-CAD-Fc protein were detected with the following antibodies: mouse-anti-DSG2 (#BM5016, Origene, 1:200); mouse-anti-DSG3 5G11 (#32-6300 ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were transfected either with scramble SiRNA (10 nM) or MAS-1 SiRNA (10 nM) according to manufacturer’s instructions (Origene Technologies, Rockville, MD, USA). Two days after transfection ...
-
bioRxiv - Neuroscience 2021Quote: Membranes were blocked for 1 hour at room temperature with Odyssey blocking buffer (Li-Cor, Lincoln, NE, USA) and were then incubated with mouse anti-TurboGFP (1:2000; Origene, Rockville, MD, USA) and rabbit anti-β-tubulin (1:5000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were blocked in TBS-T (1% Tween 20) with 5% BSA for 30 min and incubated with primary antibody against human ABCD1 (1:1,000; Origene, MD, US; Cat. No. TA803208) and β-actin (1:1,000 ...