Labshake search
Citations for Origene Technologies :
51 - 100 of 307 citations for 6 4 METHOXY PHENYL 2 PHENYL PYRAZOLO 1 5 A PYRIMIDINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... HEK293T cells were seeded at a density of 1.4x105 cells per well in 6-well plates and transfected with 0.5-2.5ug of LRRC37A plasmid (Origene) or empty vector control (Origene ...
-
bioRxiv - Cell Biology 2020Quote: ... siERCC8 (5′-GGAGAACAGAUAACUAUGCUUAAGG −3′) and siRNA duplex control (Origene) was diluted with DMEM to a final concentration of 20□nM ...
-
bioRxiv - Cancer Biology 2021Quote: ... RAW 264.7 cells were treated with 5 ng/ml murine recombinant IL-18 protein or 5 ng/mL murine recombinant IL-20 protein (Origene, Rockville, MD, USA) for 72 hours ...
-
bioRxiv - Microbiology 2020Quote: ... and dipeptidyl peptidase-4 (DPP4) cDNA clones were obtained from Origene, and cloned into a pcDNA3 vector (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... which were prepared using 10 pmol/well (of 6 well cell culture plate) Acot2 or control siRNA (Origene) and 1.5ul of Lipofectamine RNAiMAX using forward transfection ...
-
bioRxiv - Genetics 2021Quote: ... alpha 2 (IFNA2) (OriGene Technologies Inc, Atlanta, GA) (100 ng/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... TFE3 variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cancer Biology 2020Quote: ... human VDR transcript variant 2 cDNA (OriGene, RC519628) was transfected into the SKOV3 cells using Lipofectamine 2000TM (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... wells containing 2 µg of human PLG (Origene) were incubated with 3 µg of D-Val-Leu-Lys 4-nitroanilide dihydrochloride chromogenic substrate (S-2251 ...
-
bioRxiv - Molecular Biology 2021Quote: ... About 160,000 HAP1 cells per well were plated in 6-well plate and on the next day transfected using TurboFectin 8.0 (OriGene) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... 293T cells were co-trasfected with 1μg per well of 6-well plate of either pCAGGS/GST or pCAGGS/GSTVPS28 and with with 1μg per well of 6-well plate of pCMV6-Entry-AKTIP-Myc-Flag (ORIGENE) or with 1μg per well of 6-well plate of AKTIP-HA (pCR3.1 ...
-
bioRxiv - Biochemistry 2022Quote: ... HEK293-Klotho cells were seeded at density of 500 000 cells/well on 6-well tissue culture plates and transfected with RhoGDI1 (ARHGDIA) (NM_004309) Human Tagged ORF Clone (RG200902 OriGene) using Lipofectamine 3000 Transfection Reagent (L3000015 Invitrogen ...
-
bioRxiv - Physiology 2022Quote: ... coated 6-well plates (SPL Life Sciences Co., Korea) with Kcnq4 Mouse Tagged ORF Clone (OriGene, Rockville, MD, USA) using Lipofectamine LTX and Plus Reagents (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... About 5 x 106 HEK-293T cells were transfected with 5 µg of the plasmid pCMV6-XL5 HSD2 (SC122552, OriGene Technologies, Inc., Rockville, MD, USA) using the Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... were coated with various concentrations of purified recombinant caspase-4 (Origene, TP760359) overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-desmoglein-2 mouse monoclonal (Origene, Rockville, MD, USA), anti-E-cadherin mouse monoclonal (BD ...
-
bioRxiv - Neuroscience 2020Quote: ... and mitofusin 2 (Mfn) was obtained from OriGene (SC114726). To generate MG constructs ...
-
bioRxiv - Cancer Biology 2020Quote: ... C-kit Variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cancer Biology 2021Quote: We purchased paraffin-embedded sections of prostate specimens from 6 healthy volunteers and 11 patients with prostate cancer (OriGene Technologies). Characteristics of human patients with prostate cancer are summarized in table S3.
-
bioRxiv - Genetics 2020Quote: ... 10 μg of plasmid DNA (4 variants of shRNA carrying plasmids, OriGene TL501619) DNA was used to transfect one plate ...
-
bioRxiv - Biochemistry 2021Quote: ... anti-SARS-CoV-2 Spike Protein was purchased from Origene Technologies Inc ...
-
bioRxiv - Zoology 2023Quote: ... an empty vector or human MD-2 (OriGene, cat. #RC204686) were transiently expressed ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells (3×106 cells) were seeded in a 10 cm dish and transfected with 6 μg of FLAG-tagged human CREBBP plasmids (Origene,USA) using Metafectene (Biontex ...
-
bioRxiv - Microbiology 2024Quote: ... seed in a 6-well plate were transiently co-transfected with 200 ng of a myc-tagged FOS (pCMV6-FOS, OriGene, RC202597) and 600 ng of a wt ORF57 (pVM7 ...
-
bioRxiv - Genomics 2021Quote: ... Samples were incubated 1h at 4°C with anti-MYC magnetic beads (TA150044, Origene). Beads were washed 5 times with lysis buffer without inhibitors ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were transduced with a set of 4 shRNAs against Spry4 (OriGene, cat.#HC108594) or shRNA negative control (OriGene ...
-
bioRxiv - Genomics 2019Quote: ... For the 5’ eQTL a 250 bp construct containing the rs17168486 SNP (Origene) was subcloned into the Firefly luciferase reporter vector pGL4.23 (Promega ...
-
bioRxiv - Cancer Biology 2021Quote: ... Increasing concentrations (0, 2.5, 5 and 10 nM) of scrambled (scr, OriGene, SR30004) or ABCE1 siRNAs diluted in OptiMEM (Thermofisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A, OriGene, Rockville, MD, USA) and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B, OriGene, Rockville, MD, USA). A shRNA 29-mer scrambled shRNA was used as a negative control (TR30021V ...
-
bioRxiv - Cell Biology 2021Quote: ... primary antibody was applied overnight at 4 °C including antibodies against β-catenin (cat# AB0095-200, OriGene), β-Actin (cat# 4967 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stable cell lines were stablished transducing cells with a set of 4 shRNAs against Mdm2 (Origene, cat.#TL311529) or shRNA negative control (Origene ...
-
bioRxiv - Developmental Biology 2021Quote: ... cells were transduced (MOI=2) with a lentivirus constitutively expressing GFP (OriGene Tech # PS100093V). A pure GFP population was generated with puromycin selection for a few days in culture before use in experiments and cell line storage.
-
bioRxiv - Molecular Biology 2020Quote: ... China) and Native ORF cIAP-2 clone in pCMV vector was purchased from Origene, Rockville ...
-
bioRxiv - Cancer Biology 2019Quote: ... KDELR3 transcript variant 2 (NM_016657) Human Myc-DDK-tagged ORF Clone (Origene, CAT#: RC216726), KDELR3 transcript variant 1 (NM_006855 ...
-
bioRxiv - Cell Biology 2023Quote: ... [TL51074CB 5’ –AGACCGTAAACGCTATCAGCAAGAAGTAG] are in the plasmid backbone pGFP-C-shLenti and were from Origene (Rockville, MD). The non-targeting shRNA control ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were generated after transfection with pRS-puro-shWRN (5′-AGGCAGGTGTAG-GAATTGAAGGAGATCAG-3′; sequence ID: TI333414 Origene) and puromycin selection (Palermo et al. ...
-
bioRxiv - Genomics 2021Quote: ... containing a single guide RNA target sequence 5’-TAGGTCGCCAAAATCCACAC-3’ or the pCas-Guide CRISPR vector (OriGene, KN519669G2) containing a single guide RNA target sequence 5’-CGAGGCGTTTGACCCACCAG-3’ or a combination of the two was transfected into the mouse submandibular salivary gland cell line SIMS using Thermo Fisher’s Lipofectamine 3000 Reagent kit in the following manner ...
-
bioRxiv - Genomics 2019Quote: ... Control or CGGBP1-shmiR (targeting 4 different regions in CGGBP1 ORF) or CGGBP1-overexpression lentivirus constructs were obtained from Origene. The third generation lenti-packaging plasmids ...
-
bioRxiv - Biochemistry 2021Quote: ... Expression constructs encoding Myc-Flag-tagged (C- end) mouse CNNM1-4 and ARL15 in the pCMV6-Entry expression vector were acquired from OriGene (MR218318 for CNNM1 ...
-
bioRxiv - Plant Biology 2023Quote: ... overnight at 4°C (anti-PsbA; AS05 084A; anti-PsaB; AS10 695; anti-APC; AS08 277; Agrisera, anti-His tag; TA150087; OriGene). The membrane was washed 3 times in TBST-T at room temperature for 15 minutes each wash followed by incubation with secondary polyclonal anti-rabbit antisera HRP for one hour at room temperature in TBS-T (Jackson ImmunoResearch ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HEK293-Null2 cells were also co-transfected with a human MD-2 expression clone (OriGene, RC204686). JetPRIME (Polyplus ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sections were then incubated overnight at 4 °C with one of the following primary antibodies: rabbit polyclonal anti-mGFP (TA150122, OriGene, USA), mouse anti-hNuclei ...
-
bioRxiv - Molecular Biology 2022Quote: A 1.6-kb full length human PAX9 cDNA clone (GeneBank™, accession number NM_006194.1) containing 5’ and 3’ UTRs was purchased from OriGene Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: Western blot antibodies for GOT2 detection were rabbit anti-human GOT-2 polyclonal antibody (Origene, catalog #TA325088) and HRP-conjugated AffiniPure Goat anti-rabbit IgG (ThermoFisher ...
-
bioRxiv - Biophysics 2022Quote: ... Msi-2 cDNA (residues 234–328, according to the alignment with Msi-1C) was purchased from OriGene. All these variants were constructed in a pET21 vector backbone with a hexa-histidine tag on the C-terminus of the expressed protein ...
-
bioRxiv - Cell Biology 2022Quote: ... ATG7-/- and Scr Caco-2 cells as discussed previously.11 Occludin ORF in pCMV6-AC-GFP (Origene) and corresponding control plasmid were used to transfect Caco-2 cells using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... 0.64 μg of pMD2G-VSVG and 0.64 μg of pspAX.2 using transfecting reagent Megatran 1.0 (Origene).
-
bioRxiv - Neuroscience 2022Quote: ... and anti-HCRTR1 from rabbit (Origene Cat#TA328918; 1:100–1:500). Donkey IgG secondary antibodies coupled to Alexa-594 ...
-
bioRxiv - Neuroscience 2020Quote: ... NDUFAF1 (1:2,000, Origene), TOM20 (1:500 ...