Labshake search
Citations for Origene Technologies :
201 - 250 of 320 citations for 6' CHLORO 2' 3' DIHYDRO 1'H SPIRO CYCLOPROPANE 1 4' ISOQUINOLINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... The cleared medium was supplemented with 1:5 Lenti Concentrator (OriGene, Rockville, MD, USA) and incubated 2-4 hours at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Galectin-3-binding protein ORF was subcloned from its source vector (Origene # RC204918) into bicistronic lentiviral transfer vector pHR-CMV-TetO2 3C-TwinStrep-IRES-EmGFP vector (Addgene ...
-
bioRxiv - Microbiology 2020Quote: ... and dipeptidyl peptidase-4 (DPP4) cDNA clones were obtained from Origene, and cloned into a pcDNA3 vector (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... which were prepared using 10 pmol/well (of 6 well cell culture plate) Acot2 or control siRNA (Origene) and 1.5ul of Lipofectamine RNAiMAX using forward transfection ...
-
bioRxiv - Genetics 2021Quote: ... alpha 2 (IFNA2) (OriGene Technologies Inc, Atlanta, GA) (100 ng/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... TFE3 variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cancer Biology 2020Quote: ... human VDR transcript variant 2 cDNA (OriGene, RC519628) was transfected into the SKOV3 cells using Lipofectamine 2000TM (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... wells containing 2 µg of human PLG (Origene) were incubated with 3 µg of D-Val-Leu-Lys 4-nitroanilide dihydrochloride chromogenic substrate (S-2251 ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse monoclonal antibody directed against α1-actinin (#TA500072S, IF dilution 1:100) was from Origene. Phalloidin-Alexa488 ...
-
bioRxiv - Genomics 2021Quote: ... and polyclonal anti-rabbit IgG-HRP raised in goat (R1364HRP, 1:5,000; OriGene, Herford, Germany)
-
bioRxiv - Bioengineering 2022Quote: ... A 1:60 dilution of HER2 expressing whole cell lysate in RIPA buffer (Origene LY417979), or a lysate control (Origene LY500001) ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentivirus containing supernatant was concentrated 1:50 as described by the manufacturer (Origene, catalog # TR30026), flash frozen in liquid nitrogen and stored at −80°C ...
-
bioRxiv - Biochemistry 2019Quote: ... Cells were then incubated with 1:100 dilution of anti-La (Origene Technologies, #TA-00406) and 1:100 dilution of anti-Rab7 (Santa Cruz ...
-
bioRxiv - Neuroscience 2023Quote: ... Full-length cDNA for Human KCNT1 Transcript 1 NM_020822.1 (Origene Technologies Inc, Rockville, MD, USA) was mutagenised to induce point mutations ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mutant PES1 (#CW306514) and POLR2K (#CW306515) 3’UTR clones were all purchased from Origene. Mutant 3’UTR plasmids were generated by synthesizing 3’ UTR sequences in which the three GCCCCC seed matches in the 3’ UTR of PES1 and one in 3’ UTR of POLR2K was each changed to TGCAAA and this altered sequence was each inserted into the pmiRTarget construct by Origene ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A, OriGene, Rockville, MD, USA) and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B ...
-
bioRxiv - Molecular Biology 2021Quote: ... About 160,000 HAP1 cells per well were plated in 6-well plate and on the next day transfected using TurboFectin 8.0 (OriGene) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... 293T cells were co-trasfected with 1μg per well of 6-well plate of either pCAGGS/GST or pCAGGS/GSTVPS28 and with with 1μg per well of 6-well plate of pCMV6-Entry-AKTIP-Myc-Flag (ORIGENE) or with 1μg per well of 6-well plate of AKTIP-HA (pCR3.1 ...
-
bioRxiv - Biochemistry 2022Quote: ... HEK293-Klotho cells were seeded at density of 500 000 cells/well on 6-well tissue culture plates and transfected with RhoGDI1 (ARHGDIA) (NM_004309) Human Tagged ORF Clone (RG200902 OriGene) using Lipofectamine 3000 Transfection Reagent (L3000015 Invitrogen ...
-
bioRxiv - Physiology 2022Quote: ... coated 6-well plates (SPL Life Sciences Co., Korea) with Kcnq4 Mouse Tagged ORF Clone (OriGene, Rockville, MD, USA) using Lipofectamine LTX and Plus Reagents (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... were coated with various concentrations of purified recombinant caspase-4 (Origene, TP760359) overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-desmoglein-2 mouse monoclonal (Origene, Rockville, MD, USA), anti-E-cadherin mouse monoclonal (BD ...
-
bioRxiv - Neuroscience 2020Quote: ... and mitofusin 2 (Mfn) was obtained from OriGene (SC114726). To generate MG constructs ...
-
bioRxiv - Cancer Biology 2020Quote: ... C-kit Variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... OxtR protein expression was assessed by immunostaining with goat anti-rat OXTR antibody (1:100; Origene) and revealed with Alexa Fluor® 594 labeled rabbit anti-goat antibody (1:300 ...
-
bioRxiv - Cancer Biology 2022Quote: ... along with 1 μg of pCMV-Entry-Empty or pCMV-Entry-ETV7 plasmid (Origene and(20)) ...
-
bioRxiv - Cancer Biology 2019Quote: ... The KDELR3 shRNA recognition sequence was edited (t210c_c213a_t216c_t219c_a222c) from Myc-DDK-tagged KDELR3 transcript variant 1 construct (RC201571, OriGene). TOPO cloning was used to clone place this sequence into the Gateway cloning system and the pENTR L1/L2 plasmid was combined with C413-E19 pPol2 L4/R1 and pDEST-658 R4/R2 destination plasmids ...
-
bioRxiv - Genetics 2020Quote: ... slices were incubated with mouse antibody against human TP53 (1:150) (ZSGB-BIO ORIGENE, Beijing, China) at 4°C followed by secondary antibody (Dako Cytomation ...
-
bioRxiv - Cell Biology 2020Quote: ... the samples were immunostained with the anti-IRSp53/BAIAP2 antibody 1D9 (mouse monoclonal, 1:200, OriGene) and anti-HLA A antibody EP1395Y (rabbit monoclonal ...
-
bioRxiv - Immunology 2023Quote: ... tagged ADA2 was pulled down using 1 µg anti-DDK (FLAG) clone OTI4C5 (#TA50011, OriGene Technologies). An isotype control sample was incubated with 1 µg mouse IgG1 (#02-6100 ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary and secondary antibodies were used at the following concentrations: anti-dendra2 1:5000 (OriGene: TA150090), anti-Slack 1:5000 (Aves labs ...
-
bioRxiv - Cancer Biology 2021Quote: We purchased paraffin-embedded sections of prostate specimens from 6 healthy volunteers and 11 patients with prostate cancer (OriGene Technologies). Characteristics of human patients with prostate cancer are summarized in table S3.
-
bioRxiv - Neuroscience 2021Quote: ... hippocampal neurons were treated at DIV 3 with AAV1mCherry-pU6-Kv2.1 shRNA designed by OriGene (target sequence ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B, OriGene, Rockville, MD, USA). A shRNA 29-mer scrambled shRNA was used as a negative control (TR30021V ...
-
bioRxiv - Developmental Biology 2023Quote: ... Antibodies used are as follows: for immunoprecipitation (OriGene, CAT #TA-50011-3 and Origene, #TA150041); for western blot ...
-
bioRxiv - Neuroscience 2019Quote: ... 20 ng/ml) for 24 h in the presence or absence of 10 μg/ml polyclonal anti-NRG1 antibody (Origene, Rockville, MD), 50 μmol/L ErbB4 inhibitor AG1478 (Origene ...
-
bioRxiv - Genetics 2020Quote: ... 10 μg of plasmid DNA (4 variants of shRNA carrying plasmids, OriGene TL501619) DNA was used to transfect one plate ...
-
bioRxiv - Cell Biology 2019Quote: ... BMP2K (1-560) and BMP2K (561-1161) were PCR amplified from the template ORF clone # RC215795 (Origene) and inserted into HindIII restriction site of pEGFP-N1 vector using In-Fusion cloning technology (Clontech ...
-
bioRxiv - Cancer Biology 2021Quote: Purified RPRM peptides (77-109, ChinaPeptides; 1 μg) were incubated with purified recombinant CDK4 (Origene; 0.2 μg) and CDK6 proteins (Origene ...
-
bioRxiv - Neuroscience 2021Quote: ... For knockdown experiments four pGFP-C-shLenti vectors containing different shRNAs against Skap2 (Origene; see Table 1) were applied and scrambled shRNA was used as control (OriGene ...
-
bioRxiv - Microbiology 2020Quote: ... human MSR1 (Cat# RC209609) and Beclin 1 (Cat# MR207162) were obtained from Origene (Rockville, MD 20850, USA). pcDNA-FLAG-Ulk1 (Plasmid # 27636 ...
-
bioRxiv - Cell Biology 2022Quote: The full length of human PCDH15-CD1-1 (Q99PJ1, uniport) cloned in pcDNA3.1 was obtained from OriGene. PCDH15-CD2 (Q99PJ1-10 ...
-
bioRxiv - Neuroscience 2022Quote: ... were double immunostained using the following antisera couples: a) rabbit polyclonal anti-GLP-1R (1:50; Origene) and mouse monoclonal anti-NUCB2/nesfatin-1 antibody (1:50 ...
-
bioRxiv - Cell Biology 2023Quote: ... EGFP was cloned at the C terminus of the coding sequence of Pitx2 isoform 1 (Origene; MR227617). Lentivirus particles were generated as previously described 69 ...
-
bioRxiv - Cell Biology 2023Quote: ... and GFP tagged plasmid with JPh44 translating region (GFP-Δ(1-240) JPh1) were created by OriGene Technologies (Rockville ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μm-thick paraffin sections were deparaffinized and stained with anti-human KI67 (1:500, TA802544, Origene), anti-mouse Ki67 (1:800 ...
-
bioRxiv - Biochemistry 2021Quote: ... anti-SARS-CoV-2 Spike Protein was purchased from Origene Technologies Inc ...
-
bioRxiv - Zoology 2023Quote: ... an empty vector or human MD-2 (OriGene, cat. #RC204686) were transiently expressed ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells (3×106 cells) were seeded in a 10 cm dish and transfected with 6 μg of FLAG-tagged human CREBBP plasmids (Origene,USA) using Metafectene (Biontex ...
-
bioRxiv - Microbiology 2024Quote: ... seed in a 6-well plate were transiently co-transfected with 200 ng of a myc-tagged FOS (pCMV6-FOS, OriGene, RC202597) and 600 ng of a wt ORF57 (pVM7 ...