Labshake search
Citations for Origene Technologies :
401 - 435 of 435 citations for Recombinant Human LDLR protein GST tagged since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... HESCs were transfected with an empty expression plasmid (control) or human KISS1R expression plasmid corresponding to the open reading frame (Origene) or human ESR1 expression plasmids hESR1-46 or hESR1-66 (Flouriot ...
-
bioRxiv - Genomics 2024Quote: Human TOP3A-Myc-FLAG cDNA ORF (CAT#: RC208236) and human TOP3B-Myc-FLAG cDNA ORF (CAT#: RC223204) Clones were purchased from OriGene. Site-directed mutagenesis was performed using QuikChange II XL site-directed mutagenesis kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2024Quote: A plasmid encoding wild-type human COL2A1 (variant IIB, consensus sequence) fused to GFP was obtained from Origene (#RG221644; NM_033150). The C-terminal GFP tag was removed and replaced by a stop codon ...
-
bioRxiv - Biochemistry 2020Quote: The cDNA encoding full-length human SNED1 (fl-SNED1) cloned into pCMV-XL5 (clone SC315884) was obtained from Origene (Rockville, MD). The cDNA encoding full-length murine Sned1 cloned into pCRL-XL-TOPO (clone 40131189 ...
-
bioRxiv - Immunology 2021Quote: ... The Emory University Integrated Genomics core facility (Atlanta, GA) subcloned mouse and human Esm-1 cDNA from pCMV6 (Origene, Rockville, MD) into pT3 ...
-
bioRxiv - Cancer Biology 2022Quote: GCN2 and ATF4 knock-out cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5’-AATTTAGTTTTGTACCCTCA-3’ ...
-
bioRxiv - Neuroscience 2020Quote: pLenti-C-Myc-DDK (control) and human PLCγ2-myc-DDK (WT) in pLenti-C backbone vectors were obtained from OriGene (PS100064, RC200442L1). PLCγ2-myc-DDK was subjected to site-directed mutagenesis (QuikChange Lightning Multi Site-Directed Mutagenesis Kit ...
-
bioRxiv - Molecular Biology 2023Quote: The protein-nucleosome binding assays were carried out by incubating the purified nucleosome libraries described above and human full-length KLF4 (Origene TP306691), OCT4 (Origene TP311998) ...
-
bioRxiv - Physiology 2023Quote: ... containing the CMV promoter in front of the human FHF2-VY cDNA (NCBI Reference Sequence NM_001139500, full-length cDNA clone purchased from Origene, Rockville, MD) silently mutated in the sequence targeted by the FHF2 shRNA ...
-
bioRxiv - Genetics 2023Quote: ... were suspended in 400 µl of standard culture media lacking penicillin/ streptomycin and either 20 µg of pCMV6-AC-GFP human SOX11 (NM_003108; Origene, Maryland, US) or pCAG-eGFP (Liew et al ...
-
bioRxiv - Physiology 2021Quote: ... and with 300 ng of cDNA plasmid encoding wild-type or mutant human TRPA1 (pCMV6-XL4 vector, OriGene Technologies, Rockville, MD, USA). The cells were used 24–48 h after transfection ...
-
bioRxiv - Neuroscience 2020Quote: CaMKIIα and calmodulin expression in Drosophila cells was accomplished as follows: CaMKIIα and calmodulin coding sequences were copied from human cDNA clones CAMK2A transcript variant 2 (catalog SC109000, Origene, Rockville MD) and CALM1 Human calmodulin 1 transcript variant 1 (catalog SC115829 ...
-
bioRxiv - Microbiology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA); the goat anti-mouse MSR1 (Cat# AF1797) ...
-
bioRxiv - Microbiology 2020Quote: ... Stably transduced THF expressing human Flt-3R were generated by transduction with the lentivirus pLenti-FLT3-mGFP-P2A-Puro (OriGene Technologies RC211459L4V) followed by GFP purification after one week of Puro (800 μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA). The mouse anti-human MSR1 (Cat# MAB2708 ...
-
bioRxiv - Immunology 2023Quote: Tissue paraffin sections were stained with H&E for histopathological evaluation or with biotinylated anti-mouse-IgG (Vector; BA-9200) for the detection of immune complex deposits and anti-human IL23A (OriGene; AM20386PU-N) for the detection of human IL23A protein in various tissues.
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293/GC-A+/AT1+ and HEK293/GC-A+/AT2+ cell lines were generated from HEK293/GC-A+ transfected with lentiviral particle with clones of either human AT1 or AT2 receptor (OriGene, Rockville, MD) using polybrene transfection agent ...
-
bioRxiv - Microbiology 2020Quote: ... pRS-derived retroviral vectors expressing a scramble shRNA and shRNA targeting the mRNA of human LY6E were obtained from OriGene (Cat. No. TR311641).
-
bioRxiv - Microbiology 2021Quote: RNA interference for ATG5 and ATG7 in HepG2 cells was performed according to the protocol of ATG5/7 Human shRNA Plasmid Kits (Origene, Rockville, MD, USA). HepG2 cells (1 × 106 ...
-
bioRxiv - Molecular Biology 2022Quote: ... HC-04 cell line CYP 2D6 RNA levels were compared against commercially available human liver tissue CYP 2D6 RNA levels (OriGene Technologies, Rockville, MD). RNA was reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... OxtR protein expression was assessed by immunostaining with goat anti-rat OXTR antibody (1:100; Origene) and revealed with Alexa Fluor® 594 labeled rabbit anti-goat antibody (1:300 ...
-
bioRxiv - Neuroscience 2022Quote: 1μL (1667fmol) 13C615N4-L-Arginine13C615N2-L-Lysine Stable Isotope Labeled (SIL) β4 protein standard (Origene #PH310440) was added to each sample (total=16 samples overall ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were blocked in TBS-T (1% Tween 20) with 5% BSA for 30 min and incubated with primary antibody against human ABCD1 (1:1,000; Origene, MD, US; Cat. No. TA803208) and β-actin (1:1,000 ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA construct was generated by PCR-amplification on the pCMV6-XL5-human full-length SORL1 cDNA plasmid (pCMV6-XL5-WT-SorLAFL OriGene Technologies, Inc, Rockville, MD, USA) using the 5’ CCGGAATTCCGGCAAAATGGCGACACGGAGCAGCAGG 3’ and 5’ TGCTCTAGAGCACTACTCGTTCTCTTCTGCCAGGGG 3’ oligonucleotides ...
-
bioRxiv - Physiology 2024Quote: ... mice have a stop sequence flanked by loxP sites (loxP-stop-loxP) upstream of the human Ffar4 cDNA sequence (NM 181745, OriGene Technologies Inc., Rockville, MD, USA), both under control of the cytomegalovirus (CMV ...
-
bioRxiv - Genomics 2024Quote: ... cells were transfected with 300 ng of each sgRNA-15xPBS plasmid and 40 ng of each fluorescent protein plasmid using 3.5 µL TurboFectin 8.0 (OriGene). Media was changed at 24 hours post-transfection.
-
bioRxiv - Molecular Biology 2022Quote: ... sharing 91% homology with mouse JPH2 protein) and mouse Jcn cDNA (Accession number: NM_133723, Origene, Rockville, MD, USA) were inserted into pVN155 and pVC155 ...
-
bioRxiv - Genomics 2021Quote: ... cells were transfected with 300 ng of each sgRNA plasmid and 40 ng of each fluorescent protein plasmid using 3.5 µL TurboFectin (OriGene). For competitor experiments ...
-
bioRxiv - Physiology 2024Quote: ... which was cloned in a lentiviral plasmid carrying a green fluorescence protein (GFP) tag (cat#: TL310220, OriGene Technologies, Inc.). Cellular dilutions followed transfections using Lipofectamine 2000 for three days to facilitate cell isolation ...
-
bioRxiv - Developmental Biology 2021Quote: ... Single cells were then expanded to larger culture volumes and were screened for a reduction in Foxc1 protein levels by immunoblotting with anti Foxc1 antibodies (Origene), followed by sequencing of the Foxc1 ORF ...
-
bioRxiv - Cancer Biology 2021Quote: ... monitoring of interactions of PRKAR1a or GSK3b with HK2 was carried out in coating buffer and increasing concentration of Myc-HK2 protein (OriGene; 0-64nM ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid pCMV6-AC-GFP-rtTA-APE1 (for WT tGFP-APE1 protein) was prepared by PCR full-length APE1 from pET28HIS-hAPE1 and subcloned into pCMV6-AC-GFP-rtTA vector (Origene #PS100125) at AscI and RsrII sites ...
-
bioRxiv - Microbiology 2021Quote: ... MLV P30 protein within the pseudovirus capsid was detected using a rabbit anti-MLV-P30 polyclonal antibody (Origene, Cat. No. AP33447PU-N) and an HRP-conjugated goat anti-rabbit IgG Fc secondary antibody (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... The lentivirus contained the human ACE2 gene under control of the CMV promoter along with green fluorescent protein (GFP) also under control of a separate CMV promoter (Origene Technologies, Rockville, MD). A MOI of 20 was used for lentivirus transduction ...
-
bioRxiv - Neuroscience 2022Quote: ... Slices were then incubated with primary antibodies against green fluorescent protein (GFP, 1:500, Nacalai, 04404-84, RRID: AB_10013361) and tdTomato (1:500, OriGene, AB8181-200, RRID: AB_2722750) at room temperature for 2 h ...