Labshake search
Citations for Origene Technologies :
301 - 307 of 307 citations for Siglec 2 Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... ATAGAGCGTGCGGATAATGACAAGGAGTA), Synaptojanin 2 shRNA in pRFP-C-RS vector (cat. no. FI732825, TGTGCCTCTGCGGCAGCACCAGGTGAACT and FI732826, TTGTGGAGACAGAGCAGGCGATTTACATG) were purchased from Origene. Constructs of the following proteins were kind gifts ...
-
bioRxiv - Immunology 2022Quote: ... Cells (1 × 105) were mixed with 2 μg of 100 μg/ml of murine NEU3 expression plasmid (MR223297; Origene, Rockville, MD) in 100 μl PBS (GE Lifesciences ...
-
bioRxiv - Bioengineering 2023Quote: ... Sections were then developed using the respective Polink-2 Plus HRP with DAB kit (Origene, D87-6 Hamster D39-6 Rabbit). Sections were counterstained in Hematoxylin (EMS ...
-
bioRxiv - Molecular Biology 2024Quote: Trastuzumab light chains 1 and 2 were obtained by Tebubio Srl and cloned in the CD81-GFP vector (OriGene, 7268 bp), obtaining the antiHER2 construct (CD81-antiHER2-GFP ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Nrf2 was knocked-down by RNA interference (RNAi) using the following 19-bp (including a 2-deoxynucleotide overhang) siRNAs (Origene, Beijing, China): Nrf2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... staining was performed using Polink-2 Plus HRP Polymer and AP Polymer detection for Rb antibody kit (D39-18, Origene, Washington, USA) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then incubated for at least 20 hours at room temperature with a combination of the following primary antibodies in PBS-TX with 2% NGS or NDS: rabbit anti-α5 GABAA receptor subunit (1:200; TA338505, OriGene Tech., Rockville, USA), rabbit anti-α1 GABAA receptor subunit (1:300 ...