Labshake search
Citations for Origene Technologies :
251 - 300 of 496 citations for ST2 Human ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... transient or tetracyclin-inducible expression of human HEATR5B with an N-terminal GFP tag in human cells) were cloned by Gibson assembly with the full-length human HEATR5B open reading frame (derived from plasmid RC22610 (Origene)) and either pcDNA3.1-eGFP-linker or pcDNA5-FRT/TO-eGFP-linker plasmids (coding for eGFP and a GGSGGSGG linker ...
-
bioRxiv - Cell Biology 2023Quote: ... PRB-114P) was from Covance. Mouse monoclonal anti-human JC (clone 3C7, aka OTI3C7) (cat. TA504168) was obtained from OriGene Technologies ...
-
bioRxiv - Biochemistry 2023Quote: Plasmid pCMV6 encoding cDNA for human RHBDL2 and RHBDL4 with a C-terminal myc-FLAG tag was obtained from OriGene, USA ...
-
bioRxiv - Cell Biology 2023Quote: A recombinant hCABS1 overexpression lysate (OEL) produced in Human Embryonic Kidney 293T (HEK293T) cells (OriGene Technologies Inc., Rockville, MD, USA) was used as a positive control in WB ...
-
bioRxiv - Cell Biology 2024Quote: ... pLenti-C-Myc-DDK (RC210158L1; carrying the ORF of human CX36; GJD2; NM_020660) was obtained from Origene (Rockville, Md, USA).
-
bioRxiv - Molecular Biology 2024Quote: NSC34 and HEK293T cells were transfected with a plasmid coding for the hnRNPA2B1 (NM_002137) Human Tagged ORF Clone (Origene, RC219318) using Lipofectamine™ 3000 Transfection Reagent (Invitrogen L3000001) ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293T cells were seeded at a density of 1.4x105 cells per well in 6-well plates and transfected with 0.5-2.5ug of LRRC37A plasmid (Origene) or empty vector control (Origene ...
-
bioRxiv - Genomics 2019Quote: ... The next day each plate of cells was transfected with a mixture of both gRNA plasmids and both allele amplicons in a 0.45:0.45:0.05:0.05 ratio with a total of 18 ug of DNA per plate using Turbofectin 8.0 (Origene) and otherwise following manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: The cDNA encoding full-length human SNED1 (fl-SNED1) cloned into pCMV-XL5 (clone SC315884) was obtained from Origene (Rockville, MD). The cDNA encoding full-length murine Sned1 cloned into pCRL-XL-TOPO (clone 40131189 ...
-
bioRxiv - Genetics 2022Quote: ... For WDR34p.Arg183Trp and WDR34p.Gly394Ser mutants cells were transfected with WDR34 human Myc-DDK-tagged tagged ORF Clone (RC204288, OriGene, Rockville, Maryland, USA) and for WDR60p.Ala911Val mutant cells were transfected with WDR60 Mouse Myc-DDK-tagged tagged ORF Clone (MR217536 ...
-
bioRxiv - Neuroscience 2020Quote: pLenti-C-Myc-DDK (control) and human PLCγ2-myc-DDK (WT) in pLenti-C backbone vectors were obtained from OriGene (PS100064, RC200442L1). PLCγ2-myc-DDK was subjected to site-directed mutagenesis (QuikChange Lightning Multi Site-Directed Mutagenesis Kit ...
-
bioRxiv - Physiology 2023Quote: ... containing the CMV promoter in front of the human FHF2-VY cDNA (NCBI Reference Sequence NM_001139500, full-length cDNA clone purchased from Origene, Rockville, MD) silently mutated in the sequence targeted by the FHF2 shRNA ...
-
bioRxiv - Molecular Biology 2023Quote: The protein-nucleosome binding assays were carried out by incubating the purified nucleosome libraries described above and human full-length KLF4 (Origene TP306691), OCT4 (Origene TP311998) ...
-
bioRxiv - Genetics 2023Quote: ... were suspended in 400 µl of standard culture media lacking penicillin/ streptomycin and either 20 µg of pCMV6-AC-GFP human SOX11 (NM_003108; Origene, Maryland, US) or pCAG-eGFP (Liew et al ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells (3×106 cells) were seeded in a 10 cm dish and transfected with 6 μg of FLAG-tagged human CREBBP plasmids (Origene,USA) using Metafectene (Biontex ...
-
bioRxiv - Biochemistry 2023Quote: ... which were prepared using 10 pmol/well (of 6 well cell culture plate) Acot2 or control siRNA (Origene) and 1.5ul of Lipofectamine RNAiMAX using forward transfection ...
-
bioRxiv - Physiology 2021Quote: ... and with 300 ng of cDNA plasmid encoding wild-type or mutant human TRPA1 (pCMV6-XL4 vector, OriGene Technologies, Rockville, MD, USA). The cells were used 24–48 h after transfection ...
-
bioRxiv - Neuroscience 2020Quote: CaMKIIα and calmodulin expression in Drosophila cells was accomplished as follows: CaMKIIα and calmodulin coding sequences were copied from human cDNA clones CAMK2A transcript variant 2 (catalog SC109000, Origene, Rockville MD) and CALM1 Human calmodulin 1 transcript variant 1 (catalog SC115829 ...
-
bioRxiv - Microbiology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA); the goat anti-mouse MSR1 (Cat# AF1797) ...
-
bioRxiv - Microbiology 2020Quote: ... Stably transduced THF expressing human Flt-3R were generated by transduction with the lentivirus pLenti-FLT3-mGFP-P2A-Puro (OriGene Technologies RC211459L4V) followed by GFP purification after one week of Puro (800 μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA). The mouse anti-human MSR1 (Cat# MAB2708 ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293/GC-A+/AT1+ and HEK293/GC-A+/AT2+ cell lines were generated from HEK293/GC-A+ transfected with lentiviral particle with clones of either human AT1 or AT2 receptor (OriGene, Rockville, MD) using polybrene transfection agent ...
-
bioRxiv - Genomics 2023Quote: ... The oligoribonucleotides were incubated with either 10 µg HuR overexpressing HeLa cell whole cell extracts or 25-200 µM ELAVL1 human recombinant protein (Origene, Rockville, MD) in a 20 µL reaction mixture with 20 units of RNasin and 1X RNA binding buffer containing 20 mM HEPES (pH 7.6) ...
-
bioRxiv - Immunology 2023Quote: Tissue paraffin sections were stained with H&E for histopathological evaluation or with biotinylated anti-mouse-IgG (Vector; BA-9200) for the detection of immune complex deposits and anti-human IL23A (OriGene; AM20386PU-N) for the detection of human IL23A protein in various tissues.
-
bioRxiv - Physiology 2023Quote: ... were transiently transfected as described above with a plasmid encoding C-terminal Myc-FLAG epitope-tagged human TMEM65 (TMEM65-Myc-FLAG) (Origene #RC207368; NM_194291). Cells were transfected with empty pCMV6-Entry vector (Origene #PS100001 ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T-NF-κB cells were seeded in 24-well plate and were transfected the following day with siRNAs using the siTran 1.0 transfection reagent (Origene). The next day ...
-
bioRxiv - Molecular Biology 2021Quote: ... About 160,000 HAP1 cells per well were plated in 6-well plate and on the next day transfected using TurboFectin 8.0 (OriGene) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... 293T cells were co-trasfected with 1μg per well of 6-well plate of either pCAGGS/GST or pCAGGS/GSTVPS28 and with with 1μg per well of 6-well plate of pCMV6-Entry-AKTIP-Myc-Flag (ORIGENE) or with 1μg per well of 6-well plate of AKTIP-HA (pCR3.1 ...
-
bioRxiv - Physiology 2022Quote: ... coated 6-well plates (SPL Life Sciences Co., Korea) with Kcnq4 Mouse Tagged ORF Clone (OriGene, Rockville, MD, USA) using Lipofectamine LTX and Plus Reagents (Invitrogen ...
-
bioRxiv - Cancer Biology 2019Quote: Overexpression of LPL was performed using a human LPL clone in pCMV-6AC plasmid vector synthesized by OriGene (Rockville, MD; Cat. No. SC322258). An empty pCMV-6AC (“pCMV Neo” ...
-
bioRxiv - Microbiology 2020Quote: ... pRS-derived retroviral vectors expressing a scramble shRNA and shRNA targeting the mRNA of human LY6E were obtained from OriGene (Cat. No. TR311641).
-
bioRxiv - Molecular Biology 2022Quote: ... HC-04 cell line CYP 2D6 RNA levels were compared against commercially available human liver tissue CYP 2D6 RNA levels (OriGene Technologies, Rockville, MD). RNA was reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were transfected in 12-well plates via reverse transfection where purified empty or FLAG-tagged METTL7B overexpression plasmids (Origene) were mixed with P3000 reagent in OptiMEM at room temperature followed by Lipofectamine 3000 ...
-
bioRxiv - Microbiology 2024Quote: ... seed in a 6-well plate were transiently co-transfected with 200 ng of a myc-tagged FOS (pCMV6-FOS, OriGene, RC202597) and 600 ng of a wt ORF57 (pVM7 ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA construct was generated by PCR-amplification on the pCMV6-XL5-human full-length SORL1 cDNA plasmid (pCMV6-XL5-WT-SorLAFL OriGene Technologies, Inc, Rockville, MD, USA) using the 5’ CCGGAATTCCGGCAAAATGGCGACACGGAGCAGCAGG 3’ and 5’ TGCTCTAGAGCACTACTCGTTCTCTTCTGCCAGGGG 3’ oligonucleotides ...
-
bioRxiv - Genetics 2019Quote: A CrispR-Cas9 knockout kit (Origene, Rockville, MD) for mouse Kif26b (SKU KN308785) ...
-
bioRxiv - Neuroscience 2022Quote: ... and anti-HCRTR1 from rabbit (Origene Cat#TA328918; 1:100–1:500). Donkey IgG secondary antibodies coupled to Alexa-594 ...
-
bioRxiv - Neuroscience 2020Quote: ... NDUFAF1 (1:2,000, Origene), TOM20 (1:500 ...
-
bioRxiv - Cell Biology 2022Quote: ... using Lenti-vpak Lentiviral Packaging Kit (Origene Technologies, Inc.). The HEK 293T cells were expanded in DMEM (high glucose ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... mouse anti-ZEB2 (Origene, TA802113, IF 1:150, WB 1:2000 in milk), sheep anti-TBR2 (R&D Systems ...
-
bioRxiv - Cell Biology 2020Quote: ... Overexpressed HA-NFATc3 and endogenous Trim39 were detected using anti-HA (1:500) and anti-Trim39 (from Proteintech 1:200, from Origene 1:400) antibodies respectively ...
-
bioRxiv - Cancer Biology 2019Quote: ... Lgr5 (1:200) (Origene, TA503316), Oct4 (1:200 ...
-
bioRxiv - Cancer Biology 2021Quote: ... LHX1 (OriGene #TA504528; 1:1000); LTL-Biotinylated (Vectorlabs B-1325 ...
-
bioRxiv - Molecular Biology 2022Quote: ... tGFP (1:200 Origene, TA150041), ki67 (Medac 275R-18) ...
-
Orchestration of alternative splicing regulates bone marrow mesenchymal stem cells fate during agingbioRxiv - Cell Biology 2022Quote: ... β actin (Origene, TA811000, 1:5000), GAPDH (Origene ...
-
Orchestration of alternative splicing regulates bone marrow mesenchymal stem cells fate during agingbioRxiv - Cell Biology 2022Quote: ... GAPDH (Origene, TA802519, 1:5000), PCNA (BOSTER Biological Technology ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tff1 (OriGene, TA322883 1:100), Tff2 (Proteintech ...
-
bioRxiv - Cell Biology 2021Quote: ... Mcam (Origene, rabbit 1:1000), Mpz (AvesLab ...
-
bioRxiv - Developmental Biology 2022Quote: ... K14 (OriGene, #BP5009, 1:1000), Involucrin (Biolegend ...
-
bioRxiv - Cell Biology 2020Quote: ... tdTomato (1:200, TA180009, OriGene), HuNu (1:200 ...