Labshake search
Citations for Origene Technologies :
251 - 300 of 338 citations for Recombinant Mouse Cd1d1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: Full length mouse Lox (mLox) cDNA was purchased from OriGene. The full length ORF was amplified by PCR using forward and reverse primers respectively ...
-
bioRxiv - Neuroscience 2022Quote: Plasmids: HA-tags were attached to mouse VASH1 (Origene, MR222520) and VASH2 (Origene ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse Myc-RIP2 and Myc-TRAF6 were obtained from Origene. All high-fidelity PCR was performed using NEB Q5 polymerase and all subcloning was done using NEBuilder HiFi DNA Assembly (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lactating mammary gland protein butyrophilin (BTN1A1) anti-BTN1A1 (mouse, OriGene Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA for the coding sequence of mouse CCN1 (Origene # MR221828) was used ...
-
bioRxiv - Biochemistry 2024Quote: ... and mouse α-PUS7 monoclonal antibody (OriGene, OTI4C6; 1:1,000) followed by goat α-rabbit ...
-
bioRxiv - Cell Biology 2024Quote: ... and mouse anti-BTN3A2 antibodies (ORIGENE, USA, #CF500730, 1:50), respectively ...
-
bioRxiv - Genetics 2020Quote: Mouse expression plasmids containing cDNA encoding Rhbdf1 was obtained from OriGene. The Q5® Site-Directed Mutagenesis Kit was used to introduce site-specific mutations in the mouse Rhbdf1 plasmid according to the manufacturer’s instructions and confirmed by Sanger sequencing ...
-
bioRxiv - Cancer Biology 2020Quote: We used an Adamts12 Mouse shRNA Plasmid (OriGene, Locus ID: 239337) and transfected LLC/2-luc-M38 (Caliper ...
-
bioRxiv - Cancer Biology 2020Quote: ... was purchased from Sigma Aldrich and mouse anti-PDLIM2 Ab (1:250) was purchased from Origene. Rabbit anti-FAK Abs (1:500) ...
-
bioRxiv - Neuroscience 2019Quote: ... The mouse Scyl1 cDNA was amplified from a construct (MR210762, Origene) and cloned into an existing vector downstream of the T3 promoter ...
-
bioRxiv - Neuroscience 2022Quote: Short interference mouse PCBP1 RNAi plasmids were purchased from Origene (TL502540). Lentiviral particles expressing the PCBP1 shRNAi or scramble control were produced by the VirusTech Core Facility ...
-
bioRxiv - Immunology 2022Quote: ... The membrane was probed with anti-ZFP36 mouse monoclonal (Origene #OTI3D10) (2 μg/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mouse Pygo2 and Kit were subcloned from the original vectors (OriGene Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: Sandwich ELISA was performed with mouse anti-NDV-HN antibodies (OriGene) diluted 1:100 in PBS for 1 h to capture whole attenuated NDV (VH ...
-
bioRxiv - Biochemistry 2022Quote: The mouse Phf8 transcript (NM_177201) was purchased from Origene (Cat#: MR223276) and subcloned into a pENTR/D-TOPO vector (Thermo Fisher Scientific) ...
-
bioRxiv - Physiology 2022Quote: ... The mouse RUNX2-Myc/DDK plasmid was purchased from OriGene (MR227321), then subcloned into pLV-EF1a-IRES-Hygro (Addgene #85134) ...
-
bioRxiv - Neuroscience 2022Quote: ... Mouse P2X5 (mP2X5) cDNA in pCMV6-Entry was purchased from OriGene and subcloned into pcDNA3.1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The mouse Runx2 plasmid pCMV-Flag-mRunx2 was purchased from Origene. The fragments shown in Fig ...
-
bioRxiv - Neuroscience 2024Quote: ... with mouse monoclonal anti-FLAG antibody (anti-DDK; 1:1,000, OriGene) in blocking solution for 2–3 days ...
-
bioRxiv - Biochemistry 2024Quote: ... CDK2 mouse monoclonal antibody (HRP conjugated) [Clone ID: OTI2D9] (Origene, TA502935BM), monoclonal Anti-FLAG M2-peroxidase (HRP ...
-
bioRxiv - Immunology 2021Quote: The mouse CD8a and CD8b plasmids were purchased from Origene (Rockville, MD). Catalog numbers MR227539 and MR225204 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mouse monoclonal anti-ZsGreen1 (ZSG) clone TI2C2 (1:2000) (OriGene, Cat#: TA180002); Mouse anti-capsid (1:3000 ...
-
bioRxiv - Cell Biology 2020Quote: Mouse Add1 cDNA transcript variant 1 was purchased from Origene (Cat# MR210357). The Add1 gene was amplified and subcloned into pUC19 for point mutations by the GeneArt Site-Directed Mutagenesis Plus Kit (Life Technologies ...
-
Paracrine signalling between intestinal epithelial and tumour cells induces a regenerative programmebioRxiv - Cancer Biology 2021Quote: ... LentiThbs1Tg is a lentiORF expressing mouse Thbs1 (NM_011580) –myc-DKK (Origene #MR211744L3V). pMD2.G was a gift from Didier Trono (Addgene plasmid # 12259 ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse PRA1 cDNA was obtained from Origene (Rockville, MD, USA; Cat# MC200290). The PRA1-GFP construct was made by amplification and cloning of the PRA1 ORF into the pCAGIG vector using the XhoI/MscI restriction sites ...
-
bioRxiv - Cell Biology 2021Quote: ... The mouse AP-3μ1 expression plasmid was purchased from Origene (Ref. MR206629) and consists of AP-3μ1-myc-DDK in pCMV6-ENTRY ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse monoclonal antibody against IL-1β (Origene Inc., Cat# TA506443, 1:1000), rabbit polyclonal antibody against p65 (Abcam ...
-
bioRxiv - Molecular Biology 2023Quote: ... and mouse TMEM87A -transcript variant 1 (NM_173734; MC201598) were purchased from Origene. The coding sequences of these genes were PCR amplified and then subcloned into CMV-pIRES2-DsRed/iRFP vector using the SalI/BamHI restriction enzyme sites or CMV-EGFP-N1 vector using the EcoRI/AgeI restriction enzyme sites using the cloning kit (EZ-Fusion™ HT Cloning core Kit ...
-
bioRxiv - Immunology 2023Quote: ... and mouse anti-GAPDH monoclonal IgG (Origene TA802519, clone OTI2D9, 1:2000). Secondary antibodies were donkey anti-rabbit IgG (Alexa Fluor 790 ...
-
bioRxiv - Neuroscience 2024Quote: The pGFP-A-shAAV shRNA cloning plasmids against mouse Gprc6a (Origene, HC141118) were designed for transfection in mouse N2a cells and production for rAAVs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Constructs including human (NM_005987) and mouse Sprr1a (NM_009264) were purchased from Origene, bearing the pCMV6 vector backbone with C-terminal Myc-DDK Tag ...
-
bioRxiv - Neuroscience 2023Quote: ... Silent mutations disrupted the internal EcoRI sites of mouse KitL (MC204279, OriGene), the KitL coding sequence was then flanked by EcoRI sites ...
-
bioRxiv - Cell Biology 2020Quote: ... or α-CD68 (1:2000, mouse monoclonal, clone BM4000, OriGene Technologies, Rockville, USA). An α-mouse ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... HEI-OC1 cells were transfected with a mouse Tlr4 expression clone (Origene; MR210887) to test for complementation of the Tlr4 deletion strain ...
-
bioRxiv - Biophysics 2021Quote: ... mouse anti-human PD-L1 (primary antibody, CD273, Clone OTI9E12, ORIGENE, MD, USA) and APC goat anti-mouse IgG (secondary antibody ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... mouse anti-ZEB2 (Origene, TA802113, IF 1:150, WB 1:2000 in milk), sheep anti-TBR2 (R&D Systems ...
-
bioRxiv - Cancer Biology 2023Quote: ... and anti-LGR5 mouse monoclonal conjugated with PE at 1:100 (Origene #TA400001). Apart from the LGR5 antibody incubation (of 20 minutes) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary monoclonal antibodies included mouse anti-human ACE2 (1:1500) (Origene, Rockland, Maryland), rabbit anti-human (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse Pla2g2a-Myc-DDK construct was obtained from Origene (m-sPLA2-IIA-myc). Mouse PGRN construct was cloned into pSecTag2B vector (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... The CatSper1 ORF was amplified from a mouse cDNA clone (Cat. No. MR224271, Origene). C2cd6s was subcloned into pcDNA3.1/myc-His A vector (Cat ...
-
bioRxiv - Neuroscience 2019Quote: ... DNA sequences containing mouse C4B (NM_009780.2, synthesized by Genescript) and human C4A (RC235329, Origene) were subcloned (InFusion Kit ...
-
bioRxiv - Neuroscience 2021Quote: The pCMV6-Arc-Myc-DDK (FLAG) mouse ORF cDNA clone (MR206218) was from OriGene Biotechnologies (Rockville ...
-
bioRxiv - Cancer Biology 2021Quote: shRNAs constructs targeting human or mouse ATRX were obtained from OriGene (Rockville, MD, USA). The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA for mouse Btbd11 was purchased C-terminal Myc tag (Origene catalog number: MR217199). Using this cDNA as template pCAG-GFP-Btbd11 was generated ...
-
Mck1 defines a key S-phase checkpoint effector in response to various degrees of replication threatsbioRxiv - Molecular Biology 2019Quote: ... Hug1-13MYC protein levels were detected with mouse anti-MYC antibody (1:1000, ORIGENE) and HRP-conjugated anti-mouse IgG as the secondary antibody (1:10000 ...
-
bioRxiv - Genomics 2024Quote: Knock-out was performed using the TDG mouse Gene Knock-Out kit (Origene, KN317363). This kit contained two gRNAs that targeted the first exon of TDG gene and a donor vector that contained a GFP-Puromycin cassette to facilitate the screening process ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse monoclonal antibody directed against α1-actinin (#TA500072S, IF dilution 1:100) was from Origene. Phalloidin-Alexa488 ...
-
bioRxiv - Neuroscience 2020Quote: Full-length cDNAs encoding mouse IgSF8 (BC048387) and Tenascin-R (BC138043) were purchased from Origene and Source Bioscience ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B, OriGene, Rockville, MD, USA). A shRNA 29-mer scrambled shRNA was used as a negative control (TR30021V ...