Labshake search
Citations for Origene Technologies :
251 - 300 of 381 citations for Recombinant Human PPAR gamma Protein His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... MPXV A27L protein (OriGene Technologies, Inc BP1076, 1:1000), cleaved caspase-3 (arigo Biolaboratories Crop. ...
-
bioRxiv - Genetics 2022Quote: ... Purified NAT2 protein was purchased from OriGene (CAT#: TP761755). 2-amino-3-methylimidazo [4,5-f] quinoline (IQ ...
-
bioRxiv - Cell Biology 2020Quote: ... THP1-derived macrophages were transfected with 10 nM siRNA targeting human TRPM7 (SR310261, OriGene, USA) following the manufacturer’s instructions using siTran1.0 (OriGene ...
-
bioRxiv - Molecular Biology 2020Quote: A human cDNA panel covering 48 major tissues was obtained from Insight Biotechnology (Origene HMRT104). Two RIF1 splicing variants were amplified by competitive PCR using a single primer pair (LW030 and LW031) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The IFIH1 gene was deleted using a MDA5 (IFIH1) Human Gene Knockout Kit (OriGene, KN415661) according to the manufacturer’s instructions with target sequences (5’-CTGGATGTACATTTTCACCC-3’).
-
bioRxiv - Cell Biology 2020Quote: ... GFP-tagged human sclerostin (#RG217648)- and myc-tagged mouse sclerostin (#MR222588) were purchased from Origene. KillerRed plasmid (FP966 ...
-
bioRxiv - Neuroscience 2023Quote: ... Full-length cDNA for Human KCNT1 Transcript 1 NM_020822.1 (Origene Technologies Inc, Rockville, MD, USA) was mutagenised to induce point mutations ...
-
bioRxiv - Bioengineering 2024Quote: ... and incubated with 5 μg/ml anti-human FcγRIIa (Origene, clone OTI9G5; 5 μg/ml) in blocking solution at 4°C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... the full length of FOXM1B was amplified from FOXM1 (NM_202003) Human cDNA Clone (#SC128214, Origene) then fused with the pBMN DHFR(DD)-mVenus ...
-
bioRxiv - Cell Biology 2024Quote: U251 TMX2 KO cells were generated with the TMX2 Human Gene Knockout Kit (OriGene, KN400032). The pCas-Guide vector (OriGene ...
-
bioRxiv - Biochemistry 2021Quote: ... anti-SARS-CoV-2 Spike Protein was purchased from Origene Technologies Inc ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lactating mammary gland protein butyrophilin (BTN1A1) anti-BTN1A1 (mouse, OriGene Technologies ...
-
bioRxiv - Cell Biology 2021Quote: The vector expressing myc-DDK-tagged-human wt DDX6 was purchased from OriGene (RC209431, Rockville, MD). The helicase-deficient DDX6 E247A mutant was constructed by overlapping PCR using primers oVM506 5’-ACTTATCTGCCGCATCCAATACTATCATCTGGACATGAT-3’ and oVM507 5’-TTGGATGCGGCAGATAAGTTGCTGTCACAGGATTTTGTG-3’ ...
-
bioRxiv - Physiology 2020Quote: ... Human Flag- and myc-tagged GPT and GPT2 cDNA was obtained from Origene (RC203756 and RC209119). Mutagenesis of Ser126 to Arg in GPT and Ser153 to ARg in GPT2 was performed with the Q5 site-directed mutagenesis kit frm NEB (#E0554).
-
bioRxiv - Biophysics 2021Quote: ... DNA encoding ctSTIM1 (aa 233-685) was amplified by PCR from full-length human STIM1 (Origene), appending an N-terminal NcoI cleavage site ...
-
bioRxiv - Cell Biology 2021Quote: Cells were transiently transfected with a human KLK10-encoding plasmid (pCMV6-KLK10-Myc-DDK; Origene RC201139) at 0.1-1 μg/mL or as a control a GFP plasmid (PmaxGFP ...
-
bioRxiv - Genetics 2020Quote: ... slices were incubated with mouse antibody against human TP53 (1:150) (ZSGB-BIO ORIGENE, Beijing, China) at 4°C followed by secondary antibody (Dako Cytomation ...
-
bioRxiv - Physiology 2020Quote: ... Human Flag- and myc-tagged GPT and GPT2 cDNA was obtained from Origene (RC203756 and RC209119). Mutagenesis of Ser125 to Arg in GPT and Ser153 to Arg in GPT2 17 was performed with the Q5 site-directed mutagenesis kit from NEB (#E0554) ...
-
bioRxiv - Cancer Biology 2021Quote: ... shSlit2 CT-2A cells were infected with SLIT2 (NM_004787) Human Tagged ORF Clone Lentiviral Particle (Origene) in accordance with manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... The human full-length Mtss1 expression construct was purchased from Origene (pCMV6-hMtss1, Cat# RC218273, USA), and Myc-tagged Mtss1 deletion constructs (Mtss11I-BAR [amino acids deleted ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HEK293-Null2 cells were also co-transfected with a human MD-2 expression clone (OriGene, RC204686). JetPRIME (Polyplus ...
-
bioRxiv - Cell Biology 2023Quote: ... Human siRNA Oligo Duplex for N-Cadherin (SR300716) and α-Catenin (SR301060) were purchased from Origene. siRNA was transiently transfected to the cells through Lipofectamine RNAimax (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were transfected with either pEGFP-ARα1b or Myc-DDK-tagged human ARα1b (Origene, Rockville, MD) using Lipofectamine 3000.
-
bioRxiv - Cell Biology 2024Quote: Full-length, human, wild-type GALC cDNA (SC120078, NM_000153) was originally purchased from Origene (Rockville, MD). The cDNA was subcloned into the pBApo-CMV pur expression vector at the XbaI and PstI sites (Takara Bio ...
-
bioRxiv - Cancer Biology 2022Quote: Western blot antibodies for GOT2 detection were rabbit anti-human GOT-2 polyclonal antibody (Origene, catalog #TA325088) and HRP-conjugated AffiniPure Goat anti-rabbit IgG (ThermoFisher ...
-
bioRxiv - Biochemistry 2020Quote: ... The human doublecortin (DCX) and doublecortin-like kinases (DCLK1, DCLK2, and DCLK3) cDNAs were obtained from Origene in pCMV6 vector that also incorporates C-terminal Myc and FLAG tags (Myc-FLAG ...
-
bioRxiv - Cancer Biology 2021Quote: ... THEM6 human tagged ORF clone overexpressing plasmid and respective control (RC201709 and PS100001, Origene, Rockville, MD, USA) were purchased from Origene ...
-
bioRxiv - Microbiology 2020Quote: ... human MSR1 (Cat# RC209609) and Beclin 1 (Cat# MR207162) were obtained from Origene (Rockville, MD 20850, USA). pcDNA-FLAG-Ulk1 (Plasmid # 27636 ...
-
bioRxiv - Cancer Biology 2020Quote: ... LNCaP cells were transfected with SLFN5 (NM_144975) Human MYC-Tagged ORF Clone (RC216330, Origene, Rockville, MD, USA) or the corresponding empty vector plasmid (PS100001 ...
-
bioRxiv - Cell Biology 2022Quote: The full length of human PCDH15-CD1-1 (Q99PJ1, uniport) cloned in pcDNA3.1 was obtained from OriGene. PCDH15-CD2 (Q99PJ1-10 ...
-
bioRxiv - Physiology 2021Quote: ... Full-length human (RC211179) and mouse GCGR (MR207767) both Myc-DDK-tagged cDNA were obtained from OriGene Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... For chaperone over-expression: either human PDEδ (NM_002601.4; Dharmacon MHS6278-202829730) or mouse UNC119A (NM_005148; Origene RC203758) was cloned in front of a T2A site followed by mCherry to allow for co-translational cleavage and expression ...
-
bioRxiv - Bioengineering 2020Quote: ... to transfect GFP-tagged human tumor necrosis factor receptor superfamily 10b (GFP-TNFRSF10B/GFP-DR5) plasmid (OriGene) into the cell lines ...
-
bioRxiv - Cancer Biology 2020Quote: Three unique 27mer RELA human siRNA oligo dupliexes (SR304030A, B and C) were obtained from Origene (SR304030). Universal scrambled negative control siRNA duplex (SR30004 ...
-
bioRxiv - Cancer Biology 2020Quote: Site-directed mutagenesis was performed using 50ng of KAT3A / CBP (CREBBP) (NM_004380) Human Tagged ORF Clone (OriGene) as the dsDNA template ...
-
bioRxiv - Genomics 2021Quote: Full length human CHD4 tagged at C-terminus with Flag/Myc construct was obtained from Origene (RC224232). Full-length human GATA4 cDNA was amplified with 5’ primer (ATTAGCGATCGCCATGTATCAG ...
-
bioRxiv - Neuroscience 2022Quote: ... Myc-DDK tagged wild type human α-synuclein (Myc-α-SYN) plasmid constructs were purchased from OriGene technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μm-thick paraffin sections were deparaffinized and stained with anti-human KI67 (1:500, TA802544, Origene), anti-mouse Ki67 (1:800 ...
-
bioRxiv - Immunology 2024Quote: Quantitative PCR (qPCR) was performed on cDNA panels of 48 healthy human tissues (OriGene Technologies, Rockville, MD) and TNBC cell lines using MX3000 (Taqman probes ROPN1 ...
-
bioRxiv - Biophysics 2023Quote: A Myc/DDK eptiope-tagged Pin1 (NM_006221) Human Tagged ORF Clone (Cat# RC202543) was obtained from OriGene Technologies Inc ...
-
bioRxiv - Cell Biology 2022Quote: ... C-terminally mGFP-tagged human NRAS in pLenti-C-mGFP was purchased from OriGene (OriGene cat# RC202681L2). C-terminal mGFP was removed and eGFP tag was cloned onto the N-terminus after aberrant localization was observed upon expression in MV3 cells (presumably due to steric inhibition of C-terminal palmitoylation and farnesylation domains by the C-terminal mGFP tag) ...
-
bioRxiv - Genetics 2024Quote: The plasmid encoding wild-type human COL2A1 (variant IIB, consensus sequence) was obtained from Origene (#RG221644, NM_033150). The C-terminal GFP tag was removed and replaced by a stop codon ...
-
bioRxiv - Molecular Biology 2024Quote: The lentiviral vectors coding sequences for human-GFPT2-GFP and Mock-GFP were obtained from Origene (RC200519L2); pLVX-ATF4 mScarlet NLS (Addgene plasmid # 115969) ...
-
bioRxiv - Cell Biology 2024Quote: The cDNA encoding full-length human SNED1 cloned into pCMV-XL5 was obtained from Origene (clone SC315884). 6X-His-tagged SNED1 previously described (Vallet et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The DNPEP and ENPEP proteins were purchased from OriGene (Cat#: TP300104) and Novus Biologicals (Cat# ...
-
bioRxiv - Neuroscience 2021Quote: ... hTGR5 gene was in pCMV6-Entry (GPBAR1 Human cDNA ORF Clone, NM_001077191; Origene Technologies, Inc., Rockville, MD, USA). The two plasmids were linearized with SalI (mDAT ...
-
bioRxiv - Biochemistry 2022Quote: D-cysteine transport experiments were performed in HEK293 cells transiently transfected with human SLC1A15 (ASCT2; Origene; Cat# RC200305) and rat SLC7A10 (Asc1 ...
-
bioRxiv - Biochemistry 2020Quote: Wild-type human TREM2 (hTREM2) and DAP12 (hDAP12) were subcloned in pCMV6-A vector (Origene, Rockville, MD, USA). A single C→A nucleotide polymorphism (SNP ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNAs encoding murine (pCMV-mDHCR7-Myc/DDK) and human DHCR7 (pCMV-hDHCR7-Myc/DDK) were purchased from Origene (MR223420 and RC228922 for murine and human cDNA clone respectively) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence of full length human WNK1 was derived from a commercial expression vector (#RC218208, Origene, USA). Expression constructs needed to generate biotinylated anti-GFP nanobody for native purification from human cells are available from Addgene (#149336 ...