Labshake search
Citations for Origene Technologies :
251 - 300 of 554 citations for Mouse Anti Human IgG Fc Alexa Fluor 405 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... DNA encoding ctSTIM1 (aa 233-685) was amplified by PCR from full-length human STIM1 (Origene), appending an N-terminal NcoI cleavage site ...
-
bioRxiv - Cell Biology 2021Quote: Cells were transiently transfected with a human KLK10-encoding plasmid (pCMV6-KLK10-Myc-DDK; Origene RC201139) at 0.1-1 μg/mL or as a control a GFP plasmid (PmaxGFP ...
-
bioRxiv - Cell Biology 2021Quote: ... Purified human AXIN1-MYC/DDK (TP308349) and TPX2-MYC/DDK (TP305821) proteins were obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Physiology 2020Quote: ... Human Flag- and myc-tagged GPT and GPT2 cDNA was obtained from Origene (RC203756 and RC209119). Mutagenesis of Ser125 to Arg in GPT and Ser153 to Arg in GPT2 17 was performed with the Q5 site-directed mutagenesis kit from NEB (#E0554) ...
-
bioRxiv - Cancer Biology 2021Quote: ... shSlit2 CT-2A cells were infected with SLIT2 (NM_004787) Human Tagged ORF Clone Lentiviral Particle (Origene) in accordance with manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: Genes encoding NL-Gal3 (IDT, Coralville, IA, USA) and recombinant human Gal3 (OriGene, Rockville, MD, USA) were inserted into pET-21d(+ ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HEK293-Null2 cells were also co-transfected with a human MD-2 expression clone (OriGene, RC204686). JetPRIME (Polyplus ...
-
bioRxiv - Cell Biology 2023Quote: ... Human siRNA Oligo Duplex for N-Cadherin (SR300716) and α-Catenin (SR301060) were purchased from Origene. siRNA was transiently transfected to the cells through Lipofectamine RNAimax (Invitrogen ...
-
bioRxiv - Developmental Biology 2024Quote: ... The human full-length Mtss1 expression construct was purchased from Origene (pCMV6-hMtss1, Cat# RC218273, USA), and Myc-tagged Mtss1 deletion constructs (Mtss11I-BAR [amino acids deleted ...
-
bioRxiv - Plant Biology 2023Quote: ... overnight at 4°C (anti-PsbA; AS05 084A; anti-PsaB; AS10 695; anti-APC; AS08 277; Agrisera, anti-His tag; TA150087; OriGene). The membrane was washed 3 times in TBST-T at room temperature for 15 minutes each wash followed by incubation with secondary polyclonal anti-rabbit antisera HRP for one hour at room temperature in TBS-T (Jackson ImmunoResearch ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse Csde1 ORF clone (Origene, MR210719, NM_144901, Myc-DDK-tagged) was sub-cloned into FUGW vector including its original Myc-DDK-tag using AgeI/EcoRI restriction sites.
-
bioRxiv - Neuroscience 2021Quote: Plasmid encoding myc-tagged mouse MARCKS was purchased from Origene. Plasmid encoding HA-PKCα was a gift from Bernard Weinstein (Addgene plasmid #21232) ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse Gpr151 ORF clone (Origene, MR223707, NM_181543, Myc-DDK-tagged) was sub-cloned into FUGW vector including its original Myc-DDK-tag with no any UTRs at AgeI/EcoRI restriction sites ...
-
bioRxiv - Cancer Biology 2020Quote: Full length mouse Lox (mLox) cDNA was purchased from OriGene. The full length ORF was amplified by PCR using forward and reverse primers respectively ...
-
bioRxiv - Neuroscience 2022Quote: Plasmids: HA-tags were attached to mouse VASH1 (Origene, MR222520) and VASH2 (Origene ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse Myc-RIP2 and Myc-TRAF6 were obtained from Origene. All high-fidelity PCR was performed using NEB Q5 polymerase and all subcloning was done using NEBuilder HiFi DNA Assembly (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and HA-tagged mouse VHL ORF Clone (Origene; Cat #MR201630) as templates to amplify human and mouse VHL ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA for the coding sequence of mouse CCN1 (Origene # MR221828) was used ...
-
bioRxiv - Biochemistry 2024Quote: ... and mouse α-PUS7 monoclonal antibody (OriGene, OTI4C6; 1:1,000) followed by goat α-rabbit ...
-
bioRxiv - Cancer Biology 2019Quote: ... The TissueScan™ Tissue qPCR Array containing cDNAs for human lymphoma I-II was purchased from Origene. Relative expression of Rictor was determined using inventoried Taqman probes and PCR master mix from Applied Biosystems ...
-
bioRxiv - Biochemistry 2020Quote: ... The human doublecortin (DCX) and doublecortin-like kinases (DCLK1, DCLK2, and DCLK3) cDNAs were obtained from Origene in pCMV6 vector that also incorporates C-terminal Myc and FLAG tags (Myc-FLAG ...
-
bioRxiv - Cancer Biology 2021Quote: ... THEM6 human tagged ORF clone overexpressing plasmid and respective control (RC201709 and PS100001, Origene, Rockville, MD, USA) were purchased from Origene ...
-
bioRxiv - Microbiology 2020Quote: ... human MSR1 (Cat# RC209609) and Beclin 1 (Cat# MR207162) were obtained from Origene (Rockville, MD 20850, USA). pcDNA-FLAG-Ulk1 (Plasmid # 27636 ...
-
bioRxiv - Cancer Biology 2020Quote: ... LNCaP cells were transfected with SLFN5 (NM_144975) Human MYC-Tagged ORF Clone (RC216330, Origene, Rockville, MD, USA) or the corresponding empty vector plasmid (PS100001 ...
-
bioRxiv - Cell Biology 2021Quote: rKLK10 (500 ng, described above) was incubated with wild-type human recombinant (rHTRA1) (500 ng, Origene TP322362) or kinase-inactive rHTRA1 containing an S328A mutation (500 ng Origene TP700208 ...
-
bioRxiv - Cell Biology 2022Quote: The full length of human PCDH15-CD1-1 (Q99PJ1, uniport) cloned in pcDNA3.1 was obtained from OriGene. PCDH15-CD2 (Q99PJ1-10 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Human SCAND1 (NM_033630) ORF clone with Myc-DDK C-terminal tag (RC200079) was purchased (Origene, Rockville, MD) and designated pCMV6-ScanD1-myc-Flag ...
-
bioRxiv - Bioengineering 2020Quote: ... to transfect GFP-tagged human tumor necrosis factor receptor superfamily 10b (GFP-TNFRSF10B/GFP-DR5) plasmid (OriGene) into the cell lines ...
-
bioRxiv - Cancer Biology 2020Quote: Three unique 27mer RELA human siRNA oligo dupliexes (SR304030A, B and C) were obtained from Origene (SR304030). Universal scrambled negative control siRNA duplex (SR30004 ...
-
bioRxiv - Cancer Biology 2020Quote: Site-directed mutagenesis was performed using 50ng of KAT3A / CBP (CREBBP) (NM_004380) Human Tagged ORF Clone (OriGene) as the dsDNA template ...
-
bioRxiv - Genomics 2021Quote: Full length human CHD4 tagged at C-terminus with Flag/Myc construct was obtained from Origene (RC224232). Full-length human GATA4 cDNA was amplified with 5’ primer (ATTAGCGATCGCCATGTATCAG ...
-
bioRxiv - Biochemistry 2020Quote: ... The plasmid containing human Sirt3,102-399 (pEX-His-hSIRT3,102-399) was purchased from OriGene (Rockville, molecular dynamics).
-
bioRxiv - Cell Biology 2022Quote: ... C-terminally mGFP-tagged human NRAS in pLenti-C-mGFP was purchased from OriGene (OriGene cat# RC202681L2). C-terminal mGFP was removed and eGFP tag was cloned onto the N-terminus after aberrant localization was observed upon expression in MV3 cells (presumably due to steric inhibition of C-terminal palmitoylation and farnesylation domains by the C-terminal mGFP tag) ...
-
bioRxiv - Neuroscience 2022Quote: ... Myc-DDK tagged wild type human α-synuclein (Myc-α-SYN) plasmid constructs were purchased from OriGene technologies ...
-
bioRxiv - Biophysics 2023Quote: A Myc/DDK eptiope-tagged Pin1 (NM_006221) Human Tagged ORF Clone (Cat# RC202543) was obtained from OriGene Technologies Inc ...
-
bioRxiv - Genetics 2023Quote: The plasmid encoding wild-type human COL2A1 (variant IIB, consensus sequence) was obtained from Origene (#RG221644, NM_033150). The C-terminal GFP tag was removed and replaced by a stop codon ...
-
bioRxiv - Immunology 2024Quote: Quantitative PCR (qPCR) was performed on cDNA panels of 48 healthy human tissues (OriGene Technologies, Rockville, MD) and TNBC cell lines using MX3000 (Taqman probes ROPN1 ...
-
bioRxiv - Microbiology 2020Quote: ... anti-TRAF6 or anti-MEKK3 antibodies (all from Origene). A rabbit monoclonal anti-BST-2 antibody (Abcam ...
-
bioRxiv - Genetics 2020Quote: Mouse expression plasmids containing cDNA encoding Rhbdf1 was obtained from OriGene. The Q5® Site-Directed Mutagenesis Kit was used to introduce site-specific mutations in the mouse Rhbdf1 plasmid according to the manufacturer’s instructions and confirmed by Sanger sequencing ...
-
bioRxiv - Cancer Biology 2020Quote: We used an Adamts12 Mouse shRNA Plasmid (OriGene, Locus ID: 239337) and transfected LLC/2-luc-M38 (Caliper ...
-
bioRxiv - Neuroscience 2019Quote: ... The mouse Scyl1 cDNA was amplified from a construct (MR210762, Origene) and cloned into an existing vector downstream of the T3 promoter ...
-
bioRxiv - Neuroscience 2022Quote: Short interference mouse PCBP1 RNAi plasmids were purchased from Origene (TL502540). Lentiviral particles expressing the PCBP1 shRNAi or scramble control were produced by the VirusTech Core Facility ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mouse Pygo2 and Kit were subcloned from the original vectors (OriGene Technologies ...
-
bioRxiv - Biochemistry 2022Quote: The mouse Phf8 transcript (NM_177201) was purchased from Origene (Cat#: MR223276) and subcloned into a pENTR/D-TOPO vector (Thermo Fisher Scientific) ...
-
bioRxiv - Physiology 2022Quote: ... The mouse RUNX2-Myc/DDK plasmid was purchased from OriGene (MR227321), then subcloned into pLV-EF1a-IRES-Hygro (Addgene #85134) ...
-
bioRxiv - Neuroscience 2022Quote: ... Mouse P2X5 (mP2X5) cDNA in pCMV6-Entry was purchased from OriGene and subcloned into pcDNA3.1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The mouse Runx2 plasmid pCMV-Flag-mRunx2 was purchased from Origene. The fragments shown in Fig ...
-
bioRxiv - Biochemistry 2024Quote: ... CDK2 mouse monoclonal antibody (HRP conjugated) [Clone ID: OTI2D9] (Origene, TA502935BM), monoclonal Anti-FLAG M2-peroxidase (HRP ...
-
bioRxiv - Neuroscience 2021Quote: ... hTGR5 gene was in pCMV6-Entry (GPBAR1 Human cDNA ORF Clone, NM_001077191; Origene Technologies, Inc., Rockville, MD, USA). The two plasmids were linearized with SalI (mDAT ...
-
bioRxiv - Genetics 2020Quote: TMEM43 (Myc-DDK-tagged)-Human transmembrane protein 43 (TMEM43) (GenBank accession no. NM_024334.2) was purchased from OriGene (RC200998) and cloned into CMV-MCS-IRES2-EGFP vector using BglII/XmaI sites ...