Labshake search
Citations for Origene Technologies :
251 - 300 of 389 citations for Mouse Anti Dengue Virus Serotype 2 NS1 Antibody CM474 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... chicken anti-GFAP (1:200, Origene). Secondary antibodies ...
-
bioRxiv - Immunology 2022Quote: ... or anti-NEU4 (AP52856PU-N, Origene) antibodies as previously described.28 ...
-
bioRxiv - Immunology 2022Quote: ... 30 The anti-NEU3 (TA590228, Origene) was used at 0.5 µg/mL in PBS-BSA/500 mM NaCl/0.1% NP-40 alternative (EMD Millipore ...
-
bioRxiv - Neuroscience 2022Quote: ... anti ABHD17 (1:1000, Origene TA331704), anti ABHD17 (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-Nav1.7 (1:500, Origene, TA329033), anti-CCT5 (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-CCT5 (1:1000, Origene, TA308298), and anti-TMED10 (1:1000 ...
-
bioRxiv - Genetics 2022Quote: ... and goat anti-KLF1 (Origene TA305808). The beads were retrieved using a magnetic stand and rinsed with RIPA buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... rabbit polyclonal anti-GFP (Origene, #TP401) and mouse monoclonal anti-GFP (clone B-2 ...
-
bioRxiv - Physiology 2023Quote: ... rabbit anti-beta tubulin (Origene, TA301569), goat anti-rabbit IgG (LI-COR Biosciences ...
-
bioRxiv - Neuroscience 2019Quote: ... cells were co-transfected with a (mouse) LHX1 expression construct (Origene Technologies Inc., Rockville, MD, USA) in which Myc-DDK-tagged-LHX1 is expressed from pCMV6 ...
-
bioRxiv - Cancer Biology 2021Quote: A mouse Nup210 full length cDNA (NM_018815) encoding vector (pCMV6-Nup210-Myc) was purchased from Origene Technologies ...
-
Tumour Extracellular Vesicles Induce Neutrophil Extracellular Traps To Promote Lymph Node MetastasisbioRxiv - Cancer Biology 2023Quote: B16F10 cells were transfected with Rab27a-mouse shRNA and scramble RNA lentiviral particles purchased from Origene according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-cleaved Caspase-3 (9661S, CST, 1:500) and anti-Flag (TA-50011-100; Origene, 1:500). Cells were washed with PBS and incubated with secondary antibodies (Jackson Immunoresearch Laboratories ...
-
bioRxiv - Physiology 2021Quote: ... Full-length human (RC211179) and mouse GCGR (MR207767) both Myc-DDK-tagged cDNA were obtained from OriGene Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... For chaperone over-expression: either human PDEδ (NM_002601.4; Dharmacon MHS6278-202829730) or mouse UNC119A (NM_005148; Origene RC203758) was cloned in front of a T2A site followed by mCherry to allow for co-translational cleavage and expression ...
-
bioRxiv - Biochemistry 2021Quote: ... The expression vectors for mouse fucosyltransferases (FUTs) and L-Fringe were obtained from Origene (supplemental Fig. S1).
-
bioRxiv - Immunology 2022Quote: ... stable cell lines were produced using commercially designed lentivirus particles targeting mouse Gsdmc2 (NM_001168274.1) and Gsdmc3 (NM_183194.3) (Origene #HC108542): shRNA HC1008542A– AGTATTCAATACCTATCCCAAAGGGTTCG ...
-
bioRxiv - Neuroscience 2022Quote: pCMV6-eEF1A1 (#MG207381) and pCMV6-eEF1A2 (#MG207396) mouse ORF clones (GFP tagged) were obtained from OriGene (USA). They were subcloned into AAV2 (shortened as AAV ...
-
bioRxiv - Developmental Biology 2023Quote: ... we amplified the Sfrp2 coding sequence from an Sfrp2 (NM_009144) Mouse Tagged ORF Clone (Origene CAT#: MR204070) using CloneAmp™ HiFi PCR Premix (Takara 639298 ...
-
bioRxiv - Neuroscience 2024Quote: ... Plasmids encoding mouse KvS subunits with C-terminal myc-DDK tags were obtained from Origene (Kv6.1 (MR223857); Kv6.4 (MR224440) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HEK293-Null2 cells were also co-transfected with a human MD-2 expression clone (OriGene, RC204686). JetPRIME (Polyplus ...
-
bioRxiv - Microbiology 2020Quote: ... anti-Prx3 (Origene, TA322470, dilution 1:100) and anti-CERT (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... Goat anti-Rat IgG (OriGene Technologies, U.S.) and anti-Rab IgG secondary rabbit antibody (OriGene Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: ... and anti-ACAA2 (Origene Technologies, cat # TA506126). The slides were imaged using Nikon A1R laser scanning confocal microscope with Plan Apo 60x objective.
-
bioRxiv - Neuroscience 2021Quote: ... anti-mCherry (1:500, OriGene AB0081-500); anti-mKate2 for Brainbow 3.0 (gift of Dr ...
-
bioRxiv - Immunology 2023Quote: ... and goat anti-TdTomato (AB8181-200, Origene). The following secondary antibodies were all from Jackson ImmunoResearch unless noted ...
-
bioRxiv - Developmental Biology 2022Quote: ... and anti-KRT8 (Origene, BP5075; 1:300). For secondary antibody incubation ...
-
bioRxiv - Neuroscience 2023Quote: ... and anti-TMED10 (1:1000, Origene, TA306375), overnight at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti-GFP (catalog#TA150041, OriGene, Rockville, MD) at 1:1000 dilution ...
-
bioRxiv - Molecular Biology 2023Quote: ... rabbit anti-Spike MAb (Origene, Rockland, Maryland), diluted 1:250 ...
-
bioRxiv - Neuroscience 2023Quote: ... Anti-CSNK1G1 (IF: 1:50, OriGene, TA806333S); Anti-ROBO2 (IF ...
-
bioRxiv - Cell Biology 2023Quote: ... Anti-mCherry (Origene, Cat. No.: AB0040-200), Anti-calnexin (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-CCT1 (1:200 dilution, Origene), mouse anti-CCT5 (1:200 dilution ...
-
bioRxiv - Genetics 2024Quote: ... anti-DNA-PK (1:4000, Origene #TA314389), anti-Rabbit-IgG (1:2000 ...
-
bioRxiv - Microbiology 2020Quote: ... The slides were then incubated with an HRP-conjugated secondary antibody (OriGene) for 20 minutes at RT and stained with DAB (Vector Laboratories) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The following primary antibodies were incubated overnight: TRIM24 (1:200, TA802797, Origene), TRIM33 (1:200 ...
-
bioRxiv - Physiology 2022Quote: ... Flag immunoprecipitation was performed with antibody conjugated-magnetic beads (OriGene, Rockville, MD). The following antibodies were obtained for immunoblotting ...
-
bioRxiv - Bioengineering 2024Quote: ... Primary antibodies pan cytokeratin (PanCK, 1:100, OriGene Catalog # CF190032, Lot # F003) and vimentin (VIM ...
-
bioRxiv - Neuroscience 2020Quote: The plasmid encoding AAV-PGK-chst3 was made by amplifying the mouse chst3 sequence from plasmid MR207541 (OriGene) via the primers 5’ GGAATTCATAGGGCGGCCGGGAA 3’ and 5’ AGCGCTGGCCGGCCGTTTAAAC 3’ and was cloned into plasmid AAV-PGK-Cre (Addgene plasmid # 24593 ...
-
bioRxiv - Biochemistry 2021Quote: ... transiently co-transfected with pcDNA3.1-FIT2/V5-His and GFP-tagged MARCH6 (BC059190) Mouse Tagged ORF Clone (Origene), were pre-treated with 10 µM MG132 (Cell Signaling Technology ...
-
bioRxiv - Molecular Biology 2020Quote: The mouse YAP1 WT gene with a Myc-tag in the pCMV6 backbone was purchased from Origene (MR226049). YAP S274A and YAP S352A mutants were generated by PCR assembly ...
-
bioRxiv - Molecular Biology 2022Quote: H9c2 cells were transfected with plasmid containing DDK-tagged mouse JCN (Accession number: NM_133723, Origene, Rockville, MD, USA) or its mutant (K8R/K102R/K107R/K140R ...
-
bioRxiv - Biophysics 2024Quote: The mouse LRMP construct in PCMV6-Kan/Neo (GenBank AAH52909.1; Cat. #MC228229, Origene, Rockville, MD; Supplementary Figure 1), HCN1 in pcDNA3 (generously provided by Dr ...
-
bioRxiv - Biophysics 2022Quote: ... Msi-2 cDNA (residues 234–328, according to the alignment with Msi-1C) was purchased from OriGene. All these variants were constructed in a pET21 vector backbone with a hexa-histidine tag on the C-terminus of the expressed protein ...
-
bioRxiv - Cell Biology 2022Quote: ... ATG7-/- and Scr Caco-2 cells as discussed previously.11 Occludin ORF in pCMV6-AC-GFP (Origene) and corresponding control plasmid were used to transfect Caco-2 cells using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... 0.64 μg of pMD2G-VSVG and 0.64 μg of pspAX.2 using transfecting reagent Megatran 1.0 (Origene).
-
bioRxiv - Biophysics 2021Quote: ... Other antibodies used in this study are commercially available as follows (TRIM69, Origene; Fancm ...
-
bioRxiv - Cell Biology 2020Quote: ... We used the following primary antibodies: α-PRX3 (TA322472, rabbit; Origene, Rockville, USA), α-Mitofilin (ab48139 ...
-
bioRxiv - Neuroscience 2023Quote: Primary antibodies were purchased against β-actin (Origene, Rockville, MD, USA, OG-TA811000), CRMP1 (ProSci ...
-
bioRxiv - Cancer Biology 2023Quote: ... under gentle agitation and incubated overnight with antibodies against Arc/Arg3.1 (TA349500, OriGene), CD9 (ab236630 ...