Labshake search
Citations for Origene Technologies :
251 - 300 of 552 citations for Human KIRREL shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Plasmid expressing rat-specific shTET1 was purchased from Origene (#309902). For targeted DNA de-methylation ...
-
bioRxiv - Genetics 2022Quote: ... WT ALDH9A1 cDNA plasmid was purchased from OriGene (cat#: 216921). A nonsynonymous missense variant (c.26c>G ...
-
bioRxiv - Neuroscience 2022Quote: ... (1) the commercial template plasmid pCMV6-Entry-UBE3C (Origene #:RC215110) was amplified using primers which partially inserted the intergenic fusion sequence and simultaneously deleted the UBE3C coding sequence downstream of p.Val443 (F ...
-
bioRxiv - Cancer Biology 2020Quote: ... of the two shHIP1 constructs (Origene, HuSH pRS plasmids #TR312457) in PNT1A and DU145 followed by selection with 2.0μg/ml final concentration of Puromycin (Sigma #P9620 ...
-
bioRxiv - Developmental Biology 2019Quote: ... The cells were transfected with plasmid (pCMV6-entry from Origene) and siRNA constructs (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 7.5 μg donor plasmid (pAAVS1-Puro-DNR; Origene GE100024) containing doxycycline inducible dCas9-KRAB with Fugene HD (Promega ...
-
bioRxiv - Neuroscience 2022Quote: Plasmids: HA-tags were attached to mouse VASH1 (Origene, MR222520) and VASH2 (Origene ...
-
bioRxiv - Molecular Biology 2022Quote: ... The following plasmids were used: pCMV6-XL5-KLF4 (#SC123501; Origene) and pCMV6-Entry (#PS100001 ...
-
bioRxiv - Biochemistry 2023Quote: ... and for overexpression with lentiviral expression plasmid for DCP1b (OriGene). As a control luciferase shRNA was used ...
-
bioRxiv - Cell Biology 2024Quote: Myc-DDK-tagged ATP6V0A1 expression plasmid (RC226206, Origene, Rockville, MD) for ATP6V0A1 induction and pCMV6-Entry ...
-
bioRxiv - Cancer Biology 2024Quote: ... CD98hc overexpression plasmid pCMV6-Myc-DDK was purchased from Origene.
-
bioRxiv - Genetics 2020Quote: ... GJB2 (NM_004004) Human Tagged ORF Clone was purchased from OriGene (RC202092) and Cx30-msfGFP was purchased from Addgene (69019).
-
bioRxiv - Bioengineering 2022Quote: Human GDNF cDNA (NM_199234) was provided by OriGene (Rockville, MD, USA) that was propagated in DH5α E.coli ...
-
bioRxiv - Developmental Biology 2022Quote: A panel of 20 normal human tissues was purchased from OriGene Technologies (Rockville ...
-
bioRxiv - Immunology 2020Quote: ... The human pCMV6-AC-AQP9-GFP expression vector was from Origene. 30% H2O2 solution ...
-
bioRxiv - Cancer Biology 2022Quote: ... The human TEAD4 constructs were purchased from Origene (https://www.origene.com/; RC219686). TEAD4 full length and deletion constructs were amplified by PCR and the PCR products were sub-cloned in to a pcDNA3.1-FLAG vector ...
-
bioRxiv - Molecular Biology 2022Quote: Human siRNAs for the knock down assays were ordered from OriGene (IPO7 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human furin cDNA (product #RC204279) was obtained from OriGene (Rockville, MD) and inserted into the pcDNA5/FRT plasmid for stable transfection into HEK293 FRT cells ...
-
bioRxiv - Cell Biology 2023Quote: ... using a cDNA containing human MSI2 obtained from OriGene (Rockville, MD) as a template ...
-
bioRxiv - Immunology 2023Quote: ... CDS of IRF8 from IRF8 human tagged ORF clone (RG217646, Origene) were cloned and digested with BamHD1 and XhoI ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK cells were co-transfected with human flag-tagged PP1R6 (Origene) and His6-tagged VASP (Benz et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... PCR was performed using the human CYP4F2-myc-DDK (OriGene RC216427) plasmid (Forward primer ...
-
bioRxiv - Cancer Biology 2023Quote: ... by replacing luciferase gene with IRF4 Human Tagged ORF (Origene #RC204876). IRF4 tetracycline-inducible cell lines (RL CREBBPWT ...
-
bioRxiv - Neuroscience 2023Quote: ... Flag-tagged human GPR37L1 was purchased from Origene (Cat No. RC208132). Fabp7-mGpr37-AAV9 or mock AAV9 virus was generated by Vector Builder (Chicago ...
-
bioRxiv - Neuroscience 2023Quote: TMEM43 Human Tagged ORF Clone (NM_024334.2) was purchased from OriGene (RC200998) and cloned into CMV-MCS-IRES2-EGFP vector using BglII/XmaI sites ...
-
bioRxiv - Molecular Biology 2024Quote: The human UNG ORF clone was purchased from Origene (Catalog#: RC222868). From this plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... Recombinant human NAT10 derived from 293T cells was purchased from Origene Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... pCMV6-XL4-PPARγ (human sequence) was purchased from Origene (Rockville, MD, USA).
-
bioRxiv - Molecular Biology 2021Quote: ... Human cDNA encoding FBOX genes were procured from Origene (Rockville, MA, USA). mVenusC1 was gifted by Dr ...
-
bioRxiv - Biochemistry 2020Quote: The human cDNA clones of LRPPRC and SLIRP were provided by OriGene (product numbers ...
-
bioRxiv - Molecular Biology 2022Quote: ... GTPBP3 (NM_001128855) Human Tagged ORF Clone was purchased from Origene (cat # RC225798).
-
bioRxiv - Cell Biology 2022Quote: ... recombinant human HMGB2 (C-terminal His tag, TP720732) from ORIGENE (Rockville, MD); anti-rabbit alkaline phosphatase-linked antibody ...
-
bioRxiv - Cell Biology 2021Quote: ... prosaposin was amplified from human prosaposin cDNA (pCMV6-XL5-PSAP, Origene, # SC118405), SBP-mCherry and the Str-KDEL_SBP-mCherry-GPI (Addgene # 65295 ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant human glutaredoxin (Grx) transcript variant 1 was from Origene (cat# TP319385) (Rockville ...
-
bioRxiv - Biophysics 2022Quote: Human LRRC8A and LRRC8C cDNAs cloned into pCMV6 were purchased from OriGene Technologies ...
-
bioRxiv - Immunology 2022Quote: ... Human MR1 transcript variant 1 (NM_001531) cDNA clone was purchased from Origene. The constructs were then cloned into a lentiviral expression vector with a multiple cloning site separated from GFP reporter via an Internal Ribosomal Entry Site (IRES).
-
bioRxiv - Molecular Biology 2022Quote: 2.5ug Nudt6 Human Tagged ORF Clone (OriGene Technologies, Inc. Rockville, MD, USA) or GFP plasmid respectively were digested with XhoI for 1hr (New England Biolabs ...
-
bioRxiv - Neuroscience 2023Quote: We used a pCMV-human TFEB expressing vector from Origene (clone # sc122773), used previously 27 ...
-
bioRxiv - Physiology 2023Quote: ... For human leptin ORF clone (Origene; pCMV-leptin-DDK-Myc; CAT#: RC209259) was used for mutagenizing the AIM sequences ...
-
bioRxiv - Cancer Biology 2023Quote: ... Myc-DDK tagged human CD2-associated protein (RC210191) was purchased from Origene Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... two different anti-human DSG2 antibodies (DSG2-Origene, #BM5016; DSG2-Abcam, #ab14415) were used at 1:1000 dilutions in blocking buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Constructs including human (NM_005987) and mouse Sprr1a (NM_009264) were purchased from Origene, bearing the pCMV6 vector backbone with C-terminal Myc-DDK Tag ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transfected with Twist (TWIST1) (NM_000474) Human Tagged ORF Clone (Origene). Transfected cells underwent 3 weeks selection procedure with Neomycin (400 µg/ml) ...
-
bioRxiv - Neuroscience 2021Quote: Plasmid encoding for ABI3 (NM_016428) was purchased from OriGene (Catalog# RC202853). Site directed mutagenesis in ABI3 was performed and resulting clones were Sanger sequenced to confirm the presence of mutation ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pCMV6-Pdcd7-Myc plasmid was obtained from Origene (OriGene, #MR214517).
-
bioRxiv - Cancer Biology 2022Quote: A plasmid containing the hAHRWT sequence was purchased from Origene (RC209832). The Q383H point mutation was introduced with site-directed mutagenesis with forward primer cattgtaactcacagaccactaacagatg and reverse primer gttagtggtctgtgagttacaatgatataatc ...
-
bioRxiv - Genetics 2020Quote: Mouse expression plasmids containing cDNA encoding Rhbdf1 was obtained from OriGene. The Q5® Site-Directed Mutagenesis Kit was used to introduce site-specific mutations in the mouse Rhbdf1 plasmid according to the manufacturer’s instructions and confirmed by Sanger sequencing ...
-
bioRxiv - Neuroscience 2021Quote: ... a CMV promoter driven rat RTN3 plasmid was purchased from Origene, Rockville ...
-
bioRxiv - Cancer Biology 2020Quote: ... or the corresponding empty vector plasmid (PS100001, Origene, Rockville, MD, USA). 22Rv1 SLFN5 KO cells were further transfected with SLC7A5 (NM_003486 ...
-
bioRxiv - Cell Biology 2022Quote: ... and pCMV6 Entry Vector plasmid (pCMV6-EV) were obtained from Origene. The human FLAG-tagged EMC3 plasmid was purchased from GenScript (catalog # ...