Labshake search
Citations for Origene Technologies :
251 - 283 of 283 citations for Human Follicle Stimulating Hormone FSH Peptide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... transient or tetracyclin-inducible expression of human HEATR5B with an N-terminal GFP tag in human cells) were cloned by Gibson assembly with the full-length human HEATR5B open reading frame (derived from plasmid RC22610 (Origene)) and either pcDNA3.1-eGFP-linker or pcDNA5-FRT/TO-eGFP-linker plasmids (coding for eGFP and a GGSGGSGG linker ...
-
bioRxiv - Cell Biology 2024Quote: ... pLenti-C-Myc-DDK (RC210158L1; carrying the ORF of human CX36; GJD2; NM_020660) was obtained from Origene (Rockville, Md, USA).
-
bioRxiv - Molecular Biology 2024Quote: NSC34 and HEK293T cells were transfected with a plasmid coding for the hnRNPA2B1 (NM_002137) Human Tagged ORF Clone (Origene, RC219318) using Lipofectamine™ 3000 Transfection Reagent (Invitrogen L3000001) ...
-
bioRxiv - Cell Biology 2022Quote: ... HESCs were transfected with an empty expression plasmid (control) or human KISS1R expression plasmid corresponding to the open reading frame (Origene) or human ESR1 expression plasmids hESR1-46 or hESR1-66 (Flouriot ...
-
bioRxiv - Genomics 2024Quote: Human TOP3A-Myc-FLAG cDNA ORF (CAT#: RC208236) and human TOP3B-Myc-FLAG cDNA ORF (CAT#: RC223204) Clones were purchased from OriGene. Site-directed mutagenesis was performed using QuikChange II XL site-directed mutagenesis kit (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: USP39 (NM 006590) human mGFP-tagged ORF clone lentiviral particles (RC209551L4V) and control lentiviral particles (PS100093V) were purchased from OriGene.
-
bioRxiv - Cell Biology 2024Quote: A plasmid encoding wild-type human COL2A1 (variant IIB, consensus sequence) fused to GFP was obtained from Origene (#RG221644; NM_033150). The C-terminal GFP tag was removed and replaced by a stop codon ...
-
bioRxiv - Biochemistry 2020Quote: The cDNA encoding full-length human SNED1 (fl-SNED1) cloned into pCMV-XL5 (clone SC315884) was obtained from Origene (Rockville, MD). The cDNA encoding full-length murine Sned1 cloned into pCRL-XL-TOPO (clone 40131189 ...
-
bioRxiv - Neuroscience 2020Quote: Neurons were transfected at 12 days in vitro (DIV) with PSD95-GFP (a kind gift from David Bredt [49] and FLAG-tagged Human SRXN-1 (purchased from Origene: RC207654) for 5 h using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Immunology 2021Quote: ... The Emory University Integrated Genomics core facility (Atlanta, GA) subcloned mouse and human Esm-1 cDNA from pCMV6 (Origene, Rockville, MD) into pT3 ...
-
bioRxiv - Genetics 2022Quote: ... For WDR34p.Arg183Trp and WDR34p.Gly394Ser mutants cells were transfected with WDR34 human Myc-DDK-tagged tagged ORF Clone (RC204288, OriGene, Rockville, Maryland, USA) and for WDR60p.Ala911Val mutant cells were transfected with WDR60 Mouse Myc-DDK-tagged tagged ORF Clone (MR217536 ...
-
bioRxiv - Cancer Biology 2022Quote: GCN2 and ATF4 knock-out cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5’-AATTTAGTTTTGTACCCTCA-3’ ...
-
bioRxiv - Neuroscience 2020Quote: pLenti-C-Myc-DDK (control) and human PLCγ2-myc-DDK (WT) in pLenti-C backbone vectors were obtained from OriGene (PS100064, RC200442L1). PLCγ2-myc-DDK was subjected to site-directed mutagenesis (QuikChange Lightning Multi Site-Directed Mutagenesis Kit ...
-
bioRxiv - Molecular Biology 2023Quote: The protein-nucleosome binding assays were carried out by incubating the purified nucleosome libraries described above and human full-length KLF4 (Origene TP306691), OCT4 (Origene TP311998) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells (3×106 cells) were seeded in a 10 cm dish and transfected with 6 μg of FLAG-tagged human CREBBP plasmids (Origene,USA) using Metafectene (Biontex ...
-
bioRxiv - Physiology 2023Quote: ... containing the CMV promoter in front of the human FHF2-VY cDNA (NCBI Reference Sequence NM_001139500, full-length cDNA clone purchased from Origene, Rockville, MD) silently mutated in the sequence targeted by the FHF2 shRNA ...
-
bioRxiv - Genetics 2023Quote: ... were suspended in 400 µl of standard culture media lacking penicillin/ streptomycin and either 20 µg of pCMV6-AC-GFP human SOX11 (NM_003108; Origene, Maryland, US) or pCAG-eGFP (Liew et al ...
-
bioRxiv - Physiology 2021Quote: ... and with 300 ng of cDNA plasmid encoding wild-type or mutant human TRPA1 (pCMV6-XL4 vector, OriGene Technologies, Rockville, MD, USA). The cells were used 24–48 h after transfection ...
-
bioRxiv - Neuroscience 2020Quote: CaMKIIα and calmodulin expression in Drosophila cells was accomplished as follows: CaMKIIα and calmodulin coding sequences were copied from human cDNA clones CAMK2A transcript variant 2 (catalog SC109000, Origene, Rockville MD) and CALM1 Human calmodulin 1 transcript variant 1 (catalog SC115829 ...
-
bioRxiv - Microbiology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA); the goat anti-mouse MSR1 (Cat# AF1797) ...
-
bioRxiv - Microbiology 2020Quote: ... Stably transduced THF expressing human Flt-3R were generated by transduction with the lentivirus pLenti-FLT3-mGFP-P2A-Puro (OriGene Technologies RC211459L4V) followed by GFP purification after one week of Puro (800 μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA). The mouse anti-human MSR1 (Cat# MAB2708 ...
-
bioRxiv - Genomics 2023Quote: ... The oligoribonucleotides were incubated with either 10 µg HuR overexpressing HeLa cell whole cell extracts or 25-200 µM ELAVL1 human recombinant protein (Origene, Rockville, MD) in a 20 µL reaction mixture with 20 units of RNasin and 1X RNA binding buffer containing 20 mM HEPES (pH 7.6) ...
-
bioRxiv - Immunology 2023Quote: Tissue paraffin sections were stained with H&E for histopathological evaluation or with biotinylated anti-mouse-IgG (Vector; BA-9200) for the detection of immune complex deposits and anti-human IL23A (OriGene; AM20386PU-N) for the detection of human IL23A protein in various tissues.
-
bioRxiv - Physiology 2023Quote: ... were transiently transfected as described above with a plasmid encoding C-terminal Myc-FLAG epitope-tagged human TMEM65 (TMEM65-Myc-FLAG) (Origene #RC207368; NM_194291). Cells were transfected with empty pCMV6-Entry vector (Origene #PS100001 ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293/GC-A+/AT1+ and HEK293/GC-A+/AT2+ cell lines were generated from HEK293/GC-A+ transfected with lentiviral particle with clones of either human AT1 or AT2 receptor (OriGene, Rockville, MD) using polybrene transfection agent ...
-
bioRxiv - Neuroscience 2024Quote: ... while PLK3-HEK293 cells were produced by transfection of wild-type HEK293 cells with Myc-DDK-tagged human polo-like kinase 3 (PLK3; # RC203352, OriGene, MA, USA). All experimental procedures conducted on these cell lines were approved by the University of Sydney Institutional Biosafety Committee (#21E012).
-
bioRxiv - Microbiology 2020Quote: ... pRS-derived retroviral vectors expressing a scramble shRNA and shRNA targeting the mRNA of human LY6E were obtained from OriGene (Cat. No. TR311641).
-
bioRxiv - Microbiology 2021Quote: RNA interference for ATG5 and ATG7 in HepG2 cells was performed according to the protocol of ATG5/7 Human shRNA Plasmid Kits (Origene, Rockville, MD, USA). HepG2 cells (1 × 106 ...
-
bioRxiv - Molecular Biology 2022Quote: ... HC-04 cell line CYP 2D6 RNA levels were compared against commercially available human liver tissue CYP 2D6 RNA levels (OriGene Technologies, Rockville, MD). RNA was reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were blocked in TBS-T (1% Tween 20) with 5% BSA for 30 min and incubated with primary antibody against human ABCD1 (1:1,000; Origene, MD, US; Cat. No. TA803208) and β-actin (1:1,000 ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA construct was generated by PCR-amplification on the pCMV6-XL5-human full-length SORL1 cDNA plasmid (pCMV6-XL5-WT-SorLAFL OriGene Technologies, Inc, Rockville, MD, USA) using the 5’ CCGGAATTCCGGCAAAATGGCGACACGGAGCAGCAGG 3’ and 5’ TGCTCTAGAGCACTACTCGTTCTCTTCTGCCAGGGG 3’ oligonucleotides ...
-
bioRxiv - Physiology 2024Quote: ... mice have a stop sequence flanked by loxP sites (loxP-stop-loxP) upstream of the human Ffar4 cDNA sequence (NM 181745, OriGene Technologies Inc., Rockville, MD, USA), both under control of the cytomegalovirus (CMV ...