Labshake search
Citations for Origene Technologies :
251 - 298 of 298 citations for Human CD6 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: The cDNA encoding full-length human SNED1 (fl-SNED1) cloned into pCMV-XL5 (clone SC315884) was obtained from Origene (Rockville, MD). The cDNA encoding full-length murine Sned1 cloned into pCRL-XL-TOPO (clone 40131189 ...
-
bioRxiv - Neuroscience 2020Quote: Neurons were transfected at 12 days in vitro (DIV) with PSD95-GFP (a kind gift from David Bredt [49] and FLAG-tagged Human SRXN-1 (purchased from Origene: RC207654) for 5 h using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Immunology 2021Quote: ... The Emory University Integrated Genomics core facility (Atlanta, GA) subcloned mouse and human Esm-1 cDNA from pCMV6 (Origene, Rockville, MD) into pT3 ...
-
bioRxiv - Genetics 2022Quote: ... For WDR34p.Arg183Trp and WDR34p.Gly394Ser mutants cells were transfected with WDR34 human Myc-DDK-tagged tagged ORF Clone (RC204288, OriGene, Rockville, Maryland, USA) and for WDR60p.Ala911Val mutant cells were transfected with WDR60 Mouse Myc-DDK-tagged tagged ORF Clone (MR217536 ...
-
bioRxiv - Cancer Biology 2019Quote: For exogenous over-expression of CD82 and KDELR3 genes the following expression plasmids were used: CD82 transcript variant 1 (NM_002231) Human Untagged Clone (Origene, CAT#: SC324395), pCMV6-AC Tagged Cloning mammalian vector with non-tagged expression (Origene ...
-
bioRxiv - Neuroscience 2020Quote: pLenti-C-Myc-DDK (control) and human PLCγ2-myc-DDK (WT) in pLenti-C backbone vectors were obtained from OriGene (PS100064, RC200442L1). PLCγ2-myc-DDK was subjected to site-directed mutagenesis (QuikChange Lightning Multi Site-Directed Mutagenesis Kit ...
-
bioRxiv - Physiology 2023Quote: ... containing the CMV promoter in front of the human FHF2-VY cDNA (NCBI Reference Sequence NM_001139500, full-length cDNA clone purchased from Origene, Rockville, MD) silently mutated in the sequence targeted by the FHF2 shRNA ...
-
bioRxiv - Molecular Biology 2023Quote: The protein-nucleosome binding assays were carried out by incubating the purified nucleosome libraries described above and human full-length KLF4 (Origene TP306691), OCT4 (Origene TP311998) ...
-
bioRxiv - Genetics 2023Quote: ... were suspended in 400 µl of standard culture media lacking penicillin/ streptomycin and either 20 µg of pCMV6-AC-GFP human SOX11 (NM_003108; Origene, Maryland, US) or pCAG-eGFP (Liew et al ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells (3×106 cells) were seeded in a 10 cm dish and transfected with 6 μg of FLAG-tagged human CREBBP plasmids (Origene,USA) using Metafectene (Biontex ...
-
bioRxiv - Physiology 2021Quote: ... and with 300 ng of cDNA plasmid encoding wild-type or mutant human TRPA1 (pCMV6-XL4 vector, OriGene Technologies, Rockville, MD, USA). The cells were used 24–48 h after transfection ...
-
bioRxiv - Neuroscience 2020Quote: CaMKIIα and calmodulin expression in Drosophila cells was accomplished as follows: CaMKIIα and calmodulin coding sequences were copied from human cDNA clones CAMK2A transcript variant 2 (catalog SC109000, Origene, Rockville MD) and CALM1 Human calmodulin 1 transcript variant 1 (catalog SC115829 ...
-
bioRxiv - Microbiology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA); the goat anti-mouse MSR1 (Cat# AF1797) ...
-
bioRxiv - Microbiology 2020Quote: ... Stably transduced THF expressing human Flt-3R were generated by transduction with the lentivirus pLenti-FLT3-mGFP-P2A-Puro (OriGene Technologies RC211459L4V) followed by GFP purification after one week of Puro (800 μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA). The mouse anti-human MSR1 (Cat# MAB2708 ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293/GC-A+/AT1+ and HEK293/GC-A+/AT2+ cell lines were generated from HEK293/GC-A+ transfected with lentiviral particle with clones of either human AT1 or AT2 receptor (OriGene, Rockville, MD) using polybrene transfection agent ...
-
bioRxiv - Physiology 2023Quote: ... were transiently transfected as described above with a plasmid encoding C-terminal Myc-FLAG epitope-tagged human TMEM65 (TMEM65-Myc-FLAG) (Origene #RC207368; NM_194291). Cells were transfected with empty pCMV6-Entry vector (Origene #PS100001 ...
-
bioRxiv - Genomics 2023Quote: ... The oligoribonucleotides were incubated with either 10 µg HuR overexpressing HeLa cell whole cell extracts or 25-200 µM ELAVL1 human recombinant protein (Origene, Rockville, MD) in a 20 µL reaction mixture with 20 units of RNasin and 1X RNA binding buffer containing 20 mM HEPES (pH 7.6) ...
-
bioRxiv - Immunology 2023Quote: Tissue paraffin sections were stained with H&E for histopathological evaluation or with biotinylated anti-mouse-IgG (Vector; BA-9200) for the detection of immune complex deposits and anti-human IL23A (OriGene; AM20386PU-N) for the detection of human IL23A protein in various tissues.
-
bioRxiv - Cancer Biology 2019Quote: Overexpression of LPL was performed using a human LPL clone in pCMV-6AC plasmid vector synthesized by OriGene (Rockville, MD; Cat. No. SC322258). An empty pCMV-6AC (“pCMV Neo” ...
-
bioRxiv - Microbiology 2020Quote: ... pRS-derived retroviral vectors expressing a scramble shRNA and shRNA targeting the mRNA of human LY6E were obtained from OriGene (Cat. No. TR311641).
-
bioRxiv - Molecular Biology 2022Quote: ... HC-04 cell line CYP 2D6 RNA levels were compared against commercially available human liver tissue CYP 2D6 RNA levels (OriGene Technologies, Rockville, MD). RNA was reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were blocked in TBS-T (1% Tween 20) with 5% BSA for 30 min and incubated with primary antibody against human ABCD1 (1:1,000; Origene, MD, US; Cat. No. TA803208) and β-actin (1:1,000 ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA construct was generated by PCR-amplification on the pCMV6-XL5-human full-length SORL1 cDNA plasmid (pCMV6-XL5-WT-SorLAFL OriGene Technologies, Inc, Rockville, MD, USA) using the 5’ CCGGAATTCCGGCAAAATGGCGACACGGAGCAGCAGG 3’ and 5’ TGCTCTAGAGCACTACTCGTTCTCTTCTGCCAGGGG 3’ oligonucleotides ...
-
bioRxiv - Genetics 2019Quote: A CrispR-Cas9 knockout kit (Origene, Rockville, MD) for mouse Kif26b (SKU KN308785) ...
-
bioRxiv - Cell Biology 2022Quote: ... using Lenti-vpak Lentiviral Packaging Kit (Origene Technologies, Inc.). The HEK 293T cells were expanded in DMEM (high glucose ...
-
bioRxiv - Cancer Biology 2020Quote: CRISPR/Cas9 knockout (KO) kit was purchased from Origene (KN206895) and cell lines were generated following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: A CRISPR knockout kit for Slc35a2 was obtained from OriGene. The plasmid in this kit (pCas-Guide-Slc35a2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized using the first-strand cDNA synthesis kit (Origene) with 1 μg of total RNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mouse Pygo2 and Kit were subcloned from the original vectors (OriGene Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... reverse transcription was performed with First-strand cDNA Synthesis kit (OriGene). For RNA-seq ...
-
bioRxiv - Cancer Biology 2021Quote: ... The peroxidase reaction was developed with DAB kit (ZLI-9019, ORIGENE, Beijing, CHN) and the slides were counterstained with hematoxylin ...
-
bioRxiv - Cell Biology 2021Quote: ... and purified using PowerPrep HP Plasmid Maxiprep kits with prefilters (Origene, Rockville, MD). The SH-SY5Y neuroblastoma cells were transfected with 10 ug of plasmid DNAs when 60% confluence in 100-mm dishes using transfection reagents GenJet II (SignaGen Laboratories ...
-
bioRxiv - Cell Biology 2022Quote: ... Extracted RNA was converted to cDNA using the First Strand cDNA Synthesis kit (Origene) and then subjected to real time quantitative PCR using SYBR Green Master mix (BioRad ...
-
bioRxiv - Genomics 2024Quote: Knock-out was performed using the TDG mouse Gene Knock-Out kit (Origene, KN317363). This kit contained two gRNAs that targeted the first exon of TDG gene and a donor vector that contained a GFP-Puromycin cassette to facilitate the screening process ...
-
bioRxiv - Genomics 2021Quote: The Zcchc8 KN2.0 non-homology mediated mouse gene knockout kit (KN519669) was purchased from OriGene. Either the pCas-Guide CRISPR vector (OriGene ...
-
bioRxiv - Molecular Biology 2021Quote: ... CRISPR/Cas9 plasmid constructs were assembled using the pLenti-Cas-Guide construction Kit (GE100010, OriGene, Maryland, USA) and each sgRNA was ligated into the pLenti-Cas-sgRNA backbone as per the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... Transfections were performed using the Viromer Blue siRNA/miRNA transfection kit following the manufacturers’ instructions (Origene, Rockville, USA). Forty eight hours post siRNA treatment ...
-
bioRxiv - Cancer Biology 2023Quote: ... and packaging plasmids Lenti-vpak packaging kit with transfection reagent (TR30037) were purchased from OriGene (Rockville, MD, USA) and the experiments were conducted following the instruction of the kit.
-
bioRxiv - Cancer Biology 2019Quote: Replication incompetent lentivirus were produced in HEK 293T cells co-transfected by mixing 5 µg of either pLKO.1 Empty Vector or pLKO.1 shRNA targeting SMARCD3 with 6 µg Lenti-vpak packaging kit components (OriGene) and 33 µL of transfection reagent (OriGene ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lentiviral particles were generated by co transfection in Lenti-X™ 293T cells (Takarabio) of lentiviral packaging kit (Origene) and plasmids for the expression of IL2-GFP+ ...
-
bioRxiv - Genetics 2022Quote: ... DAB staining was performed using Polink-2 Plus HRP Polymer and AP Polymer detection for Rb antibody kit (D39-18, Origene) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... Hepatocytes were transfected with 2.75 µM dsiRNA (Integrated DNA Technologies, Coralville, IA) in nuclease-free duplex buffer using the Viromer® Blue transfection kit (Origene) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: siRNA mediated knockdown of Nt5c2 in rat primary cortical neurons was conducted using the Trilencer 27-mer NT5C2 siRNA kit (Origene: SR307908) at DIV15 per manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... Sections were then developed using the respective Polink-2 Plus HRP with DAB kit (Origene, D87-6 Hamster D39-6 Rabbit). Sections were counterstained in Hematoxylin (EMS ...
-
bioRxiv - Cell Biology 2023Quote: ... The manufacturer’s protocol was used for viral production by mixing pLenti-C-TAZ-mGFP-P2A-Puro with packaging plasmids and transfection reagent from the Lenti-vpak packaging kit (OriGene, Cat#TR30037). The mixture was transfected into HEK293T cells to generate pseudoviral particles ...
-
bioRxiv - Molecular Biology 2023Quote: ... staining was performed using Polink-2 Plus HRP Polymer and AP Polymer detection for Rb antibody kit (D39-18, Origene, Washington, USA) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: MDA-MB-231 shRNA cells were generated through lentiviral transduction using HuSH shRNA plasmid panels (29 mer) with pGFP-C-Lenti vectors and the Lenti-vpack Packaging Kit (TR30037) according to manufacturer guidelines (OriGene Technologies, Rockville, MD). shRNA plasmids included four LPL shRNAs and a negative control (TL311692) ...