Labshake search
Citations for Origene Technologies :
251 - 300 of 345 citations for Human ADH5 siRNA since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... THEM6 human tagged ORF clone overexpressing plasmid and respective control (RC201709 and PS100001, Origene, Rockville, MD, USA) were purchased from Origene ...
-
bioRxiv - Microbiology 2020Quote: ... human MSR1 (Cat# RC209609) and Beclin 1 (Cat# MR207162) were obtained from Origene (Rockville, MD 20850, USA). pcDNA-FLAG-Ulk1 (Plasmid # 27636 ...
-
bioRxiv - Cancer Biology 2020Quote: ... LNCaP cells were transfected with SLFN5 (NM_144975) Human MYC-Tagged ORF Clone (RC216330, Origene, Rockville, MD, USA) or the corresponding empty vector plasmid (PS100001 ...
-
bioRxiv - Cell Biology 2021Quote: rKLK10 (500 ng, described above) was incubated with wild-type human recombinant (rHTRA1) (500 ng, Origene TP322362) or kinase-inactive rHTRA1 containing an S328A mutation (500 ng Origene TP700208 ...
-
bioRxiv - Cell Biology 2022Quote: The full length of human PCDH15-CD1-1 (Q99PJ1, uniport) cloned in pcDNA3.1 was obtained from OriGene. PCDH15-CD2 (Q99PJ1-10 ...
-
bioRxiv - Physiology 2021Quote: ... Full-length human (RC211179) and mouse GCGR (MR207767) both Myc-DDK-tagged cDNA were obtained from OriGene Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... For chaperone over-expression: either human PDEδ (NM_002601.4; Dharmacon MHS6278-202829730) or mouse UNC119A (NM_005148; Origene RC203758) was cloned in front of a T2A site followed by mCherry to allow for co-translational cleavage and expression ...
-
bioRxiv - Bioengineering 2020Quote: ... to transfect GFP-tagged human tumor necrosis factor receptor superfamily 10b (GFP-TNFRSF10B/GFP-DR5) plasmid (OriGene) into the cell lines ...
-
bioRxiv - Cancer Biology 2020Quote: Site-directed mutagenesis was performed using 50ng of KAT3A / CBP (CREBBP) (NM_004380) Human Tagged ORF Clone (OriGene) as the dsDNA template ...
-
bioRxiv - Genomics 2021Quote: Full length human CHD4 tagged at C-terminus with Flag/Myc construct was obtained from Origene (RC224232). Full-length human GATA4 cDNA was amplified with 5’ primer (ATTAGCGATCGCCATGTATCAG ...
-
bioRxiv - Biochemistry 2020Quote: ... The plasmid containing human Sirt3,102-399 (pEX-His-hSIRT3,102-399) was purchased from OriGene (Rockville, molecular dynamics).
-
bioRxiv - Neuroscience 2022Quote: ... Myc-DDK tagged wild type human α-synuclein (Myc-α-SYN) plasmid constructs were purchased from OriGene technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μm-thick paraffin sections were deparaffinized and stained with anti-human KI67 (1:500, TA802544, Origene), anti-mouse Ki67 (1:800 ...
-
bioRxiv - Immunology 2024Quote: Quantitative PCR (qPCR) was performed on cDNA panels of 48 healthy human tissues (OriGene Technologies, Rockville, MD) and TNBC cell lines using MX3000 (Taqman probes ROPN1 ...
-
bioRxiv - Biophysics 2023Quote: A Myc/DDK eptiope-tagged Pin1 (NM_006221) Human Tagged ORF Clone (Cat# RC202543) was obtained from OriGene Technologies Inc ...
-
bioRxiv - Cell Biology 2022Quote: ... C-terminally mGFP-tagged human NRAS in pLenti-C-mGFP was purchased from OriGene (OriGene cat# RC202681L2). C-terminal mGFP was removed and eGFP tag was cloned onto the N-terminus after aberrant localization was observed upon expression in MV3 cells (presumably due to steric inhibition of C-terminal palmitoylation and farnesylation domains by the C-terminal mGFP tag) ...
-
bioRxiv - Genetics 2024Quote: The plasmid encoding wild-type human COL2A1 (variant IIB, consensus sequence) was obtained from Origene (#RG221644, NM_033150). The C-terminal GFP tag was removed and replaced by a stop codon ...
-
bioRxiv - Molecular Biology 2024Quote: The lentiviral vectors coding sequences for human-GFPT2-GFP and Mock-GFP were obtained from Origene (RC200519L2); pLVX-ATF4 mScarlet NLS (Addgene plasmid # 115969) ...
-
bioRxiv - Cell Biology 2024Quote: The cDNA encoding full-length human SNED1 cloned into pCMV-XL5 was obtained from Origene (clone SC315884). 6X-His-tagged SNED1 previously described (Vallet et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... hTGR5 gene was in pCMV6-Entry (GPBAR1 Human cDNA ORF Clone, NM_001077191; Origene Technologies, Inc., Rockville, MD, USA). The two plasmids were linearized with SalI (mDAT ...
-
bioRxiv - Genetics 2020Quote: TMEM43 (Myc-DDK-tagged)-Human transmembrane protein 43 (TMEM43) (GenBank accession no. NM_024334.2) was purchased from OriGene (RC200998) and cloned into CMV-MCS-IRES2-EGFP vector using BglII/XmaI sites ...
-
bioRxiv - Biochemistry 2022Quote: D-cysteine transport experiments were performed in HEK293 cells transiently transfected with human SLC1A15 (ASCT2; Origene; Cat# RC200305) and rat SLC7A10 (Asc1 ...
-
bioRxiv - Biochemistry 2020Quote: Wild-type human TREM2 (hTREM2) and DAP12 (hDAP12) were subcloned in pCMV6-A vector (Origene, Rockville, MD, USA). A single C→A nucleotide polymorphism (SNP ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNAs encoding murine (pCMV-mDHCR7-Myc/DDK) and human DHCR7 (pCMV-hDHCR7-Myc/DDK) were purchased from Origene (MR223420 and RC228922 for murine and human cDNA clone respectively) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence of full length human WNK1 was derived from a commercial expression vector (#RC218208, Origene, USA). Expression constructs needed to generate biotinylated anti-GFP nanobody for native purification from human cells are available from Addgene (#149336 ...
-
bioRxiv - Genetics 2020Quote: ... PRUNE1 levels in overexpressing HEK293 and in human fibroblasts were analyzed by immunoblotting using anti-PRUNE1 (Origene; TA344725) and/or anti-HA (Abcam ...
-
bioRxiv - Microbiology 2021Quote: The open reading frame of human MIF was amplified by PCR from the vector pCMV6-entry MIF (Origene) and cloned into the pET11a vector (Novagen ...
-
bioRxiv - Immunology 2021Quote: pCMV6-Entry vector encoding Myc-DKK-tagged human wild type (WT) ATAD3A cDNA (NM_018188.4, Q9NV17-1) was obtained from Origene and mutations were inserted by site-directed mutagenesis using the Q5 kit (E0554S ...
-
bioRxiv - Genetics 2020Quote: Thymidine Kinase 2 Human Untagged Clone (NM_004614) containing the cDNA for transcript variant 1 was purchased from OriGene Technologies ...
-
bioRxiv - Genetics 2020Quote: The full-length human BBS2 clone in the pCMV6-entry vector was obtained commercially (Origene; Clone ID: RC204337). Using this as a template ...
-
bioRxiv - Cancer Biology 2023Quote: ... were transformed by heat shock in 42°C water bath using SETD2 Human Tagged ORF Clone (Origene, RG224760) or pCMV6□AC□GFP Mammalian Expression Vector (Origene ...
-
bioRxiv - Cell Biology 2022Quote: ... Human ACLY(H760A) was generated by site-directed mutagenesis using the pCMV6-ACLY(MYC-FLAG) vector (Origene, RC200508). Human CPα (CAPZA1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... A clone containing the consensus ADAMTS7 coding sequence (NM_014272 Human Untagged Clone) was purchased from Origene (Rockville, USA). To generate Gateway-compatible constructs ...
-
bioRxiv - Cancer Biology 2022Quote: The human KMT5C (NM_032701.4) open reading frame (ORF) was cloned from the pCMV6-Entry expression vector (Origene, RC203881) into the pLV-EF1a-IRES-Hygro lentiviral backbone (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... to generate Jurkat BTLA/NFAT-eGFP cells or CD160 (NM_007053) Human Tagged ORF Clone Lentiviral Particles (Origene, #RC204886L3V), to generate Jurkat CD160/NFAT-eGFP cells respectively ...
-
bioRxiv - Biochemistry 2024Quote: ... the coding sequence for the first 400 aa of human BicD2 was amplified from a cDNA (Origene, SC300552) by PCR and cloned into a pETZT2 plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... Jurkat NFAT eGFP cells were transduced with CD272 (BTLA) (NM_181780) Human Tagged ORF Clone Lentiviral Particles (Origene, #RC219458L3V) to generate Jurkat BTLA/NFAT-eGFP cells or CD160 (NM_007053 ...
-
bioRxiv - Neuroscience 2020Quote: Stable cell lines were generated in HEK293 (ATCC, mycoplasma free) using a pCMV vector expressing either 1µg of mouse or human TRPC5 (Origene) co-transfected with 7µg of pBabe Puro vector for rapid stable selection ...
-
bioRxiv - Cell Biology 2021Quote: ... human TCEAL4 transcript variant 1) and pCMV6-TCEAL4 isoform-2 (CAT#: SC335597, NM_001300901, human TCEAL4 transcript variant 5) were both from Origene. TCEAL4 isoform-1 was cloned from pCMV6-TCEAL4-MYC-FLAG with the Gateway cloning system into pDONR223 and then into the destination vector pEGFP_GW ...
-
bioRxiv - Cancer Biology 2020Quote: Control cell plugs were made by transfecting PC3 cells with C-kit Variant 1 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cancer Biology 2020Quote: ... 22Rv1 SLFN5 KO cells were further transfected with SLC7A5 (NM_003486) Human Tagged ORF Clone (RC207604, Origene, Rockville, MD, USA). Cells were then clonally selected ...
-
bioRxiv - Cell Biology 2021Quote: ... NPC1 human fibroblasts were transfected with either eGFP-Vector (pCMV6-AC-GFP Tagged Cloning Vector, Cat #PS100010, Origene Technologies) or eGFP-HSP40 (DNAJB11 (NM_016306 ...
-
bioRxiv - Cell Biology 2022Quote: ... The human FLAG-tagged EMC5 plasmid (catalog #: RC207046) and FLAG-tagged EMC6 plasmid (catalog #: RC215548) were obtained from Origene. The mutations EMC3-R31A ...
-
bioRxiv - Biochemistry 2022Quote: ... HEK293-Klotho cells were seeded at density of 500 000 cells/well on 6-well tissue culture plates and transfected with RhoGDI1 (ARHGDIA) (NM_004309) Human Tagged ORF Clone (RG200902 OriGene) using Lipofectamine 3000 Transfection Reagent (L3000015 Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fifty FhNEJ per condition were washed 3 times in PBS and incubated with blocking solution (0.1% BSA in PBS) supplemented with 100 μg/ml of human PLG (Origene) for three hours at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: A 1.6-kb full length human PAX9 cDNA clone (GeneBank™, accession number NM_006194.1) containing 5’ and 3’ UTRs was purchased from OriGene Technologies ...
-
bioRxiv - Neuroscience 2023Quote: Expression vectors of Myc-DDK-tagged human ORF clones of ANKS1B and SYNGAP1 were purchased from Origene (#RC211877, #RC229432). V5-epitope or GFP-tagged mutants were cloned into the same expression backbone ...
-
bioRxiv - Physiology 2023Quote: Mammalian expression plasmid encoding human TMEM263 with a C-terminal epitope tag (Myc-DDK) was obtained from Origene (RC203933). Control pCDNA3.1 empty plasmid was obtained from Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: The pCMV6-AC-IGFBP2-GFP expression vector encoding human IGFBP2 (NM_000597) fused to the GFP in the C-terminal region was purchased from Origene Technologies (#RG202573) ...
-
bioRxiv - Bioengineering 2024Quote: Human cryosections from the aorta of a 76-year-old male with atherosclerosis were purchased from OriGene (CAT#: CS611744). Sections were stained as above with minor alterations ...