Labshake search
Citations for Origene Technologies :
201 - 250 of 573 citations for Recombinant Human High Mobility Group Box 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and Human MTERF (MTERF1) (Origene, TP761846). Proteins injected were serially diluted (two-fold each step ...
-
bioRxiv - Neuroscience 2023Quote: The human GPR37L1 cDNA clone (Origene) was subcloned into pcDNA3.1+ (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: Human CYP4F2-myc-DDK (OriGene RC216427), human
-
bioRxiv - Physiology 2023Quote: Human SLC8B1 cDNA (Origene #RC214624; NM_024959) was PCR amplified using primers to introduce a 5′ AgeI restriction site and a 3′ BamHI restriction site flanking the coding sequence ...
-
bioRxiv - Cell Biology 2023Quote: ... and Human Dlk2 pCMV6 (RC210622, Origene) vectors ...
-
bioRxiv - Neuroscience 2020Quote: ... 100 μg of lysates or 100 ng of TDP-43 recombinant protein (NM_007375, OriGene) was incubated with 30 pmol of biotin-labelled RNA for 1 h at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 0.012 μg of bacterially produced and purified recombinant IMP3 protein (Origene, cat#TP760798) in hypotonic lysis buffer (5 mM Tris ...
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid encoding GFP-tagged TRIM72 (GFP-MG53) and the corresponding empty vector (GFP-Turbo) were purchased from OriGene Technologies ...
-
bioRxiv - Cell Biology 2022Quote: 70% confluent HEK293T cells were transfected with Flag-tagged Mena in pcDNA3.1+/C-(K)DYK (obtained from Origene; Omu14068c) using calcium phosphate-based transfection ...
-
bioRxiv - Genetics 2021Quote: ... When cells reached ∼80% confluency cells were transiently transfected with NDUFAF1(NM_016013) C-Myc/DDK-tagged plasmid (Origene #RC200029) with Lipofectamine 3000 (Thermo #L3000001 ...
-
bioRxiv - Neuroscience 2021Quote: pCMV-ONCM was constructed by cloning ONCM cDNA as BamHI/NotI fragment from My c-DDK-tagged oncomodulin (OriGene) in a mammalian expression vector pCMV (Addgene) ...
-
C53 interacting with UFM1-protein ligase 1 regulates microtubule nucleation in response to ER stressbioRxiv - Cell Biology 2020Quote: ... the coding sequence without stop codon was amplified by PCR from the Myc-DDK-tagged CDK5RAP3 (tv3) plasmid (Origene Technologies ...
-
bioRxiv - Physiology 2022Quote: ... coated 6-well plates (SPL Life Sciences Co., Korea) with Kcnq4 Mouse Tagged ORF Clone (OriGene, Rockville, MD, USA) using Lipofectamine LTX and Plus Reagents (Invitrogen ...
-
bioRxiv - Developmental Biology 2019Quote: The cDNAs of UBE2D3 variants (wt, S138A, S138E, S138D) were cloned into the pET-N-His (Origene) vector containing a 6xHis N-terminal tag ...
-
bioRxiv - Molecular Biology 2021Quote: ... Human p97/VCP (NM_007126, SC125280), human UFD1L (NM_005659, SC320168), and human NPLOC4 (NM_017921, SC113845) expression plasmids were purchased from OriGene.
-
bioRxiv - Cell Biology 2021Quote: ... human TCEAL4 transcript variant 1) and pCMV6-TCEAL4 isoform-2 (CAT#: SC335597, NM_001300901, human TCEAL4 transcript variant 5) were both from Origene. TCEAL4 isoform-1 was cloned from pCMV6-TCEAL4-MYC-FLAG with the Gateway cloning system into pDONR223 and then into the destination vector pEGFP_GW ...
-
bioRxiv - Cancer Biology 2020Quote: Control cell plugs were made by transfecting PC3 cells with C-kit Variant 1 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Genomics 2020Quote: Expression constructs for the C-terminally Myc-DDK tagged canonical isoforms A3A1 (NM_145699) and A3B1 (NM_004900) cloned in the pCMV6 vector were purchased from OriGene (Rockville, MD). Open reading frames for the C-terminally Myc-DDK tagged alternative isoforms A3A2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... LSAMP stable transformants were established by transfecting COR-L279 cells with a tagged ORF clone of this gene (Origene; # RC207618) followed by 1mg/ml G418 selection (Roche ...
-
bioRxiv - Cancer Biology 2019Quote: The Myc-DDK-tagged ORF clone of Homo Sapiens MAN1B1 or pCMV6-Entry (RC202824 and PS100001, respectively, Origene, Rockville, MD) vectors were transfected in LNCaP ...
-
bioRxiv - Cell Biology 2020Quote: A non-tagged construct of mouse Gdf3 was generated using the commercial vector pCMV6-Gdf3-Myc-Flag (OriGene Technologies, MR222967), containing a Myc-Flag-tagged Gdf3 ...
-
bioRxiv - Neuroscience 2020Quote: ... MG87.TRKA and MG87.TRKB cells were transfected with PTPσ (RefSeq number NM_019140) Myc-DDK-tagged open-reading frame (ORF) plasmid purchased from OriGene (#RR209636), pCMV6-Entry vector with C-terminal Myc-DDK Tag (#PS100001 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were transfected in 12-well plates via reverse transfection where purified empty or FLAG-tagged METTL7B overexpression plasmids (Origene) were mixed with P3000 reagent in OptiMEM at room temperature followed by Lipofectamine 3000 ...
-
bioRxiv - Biochemistry 2021Quote: ... Expression constructs encoding Myc-Flag-tagged (C- end) mouse CNNM1-4 and ARL15 in the pCMV6-Entry expression vector were acquired from OriGene (MR218318 for CNNM1 ...
-
bioRxiv - Neuroscience 2024Quote: ... U251-MG cells were stably transfected with a GFP-tagged YTHDF2 expression plasmid pLenti-C-mGFP-P2A-Puro (OriGene, #RC230306L4) or GFP empty vector by lipofectamine 2000 according to the procedure recommended by the manufacturer ...
-
bioRxiv - Neuroscience 2024Quote: ... Louis, MO) (96, the C-terminal HA-tagged ERα was constructed from the purchased ERα cDNA expression clone (Origene #MG227304) into BamHI and EcoRI sites of pcDNA3 vector using PCR amplification ...
-
bioRxiv - Cell Biology 2021Quote: ... Human Plaat cDNAs were purchased from ORIGENE [RC208444 for PLAAT1 (NM_020386) ...
-
bioRxiv - Neuroscience 2021Quote: Human cDNA panels were obtained from Origene: TissueScan ...
-
bioRxiv - Biochemistry 2021Quote: ... Human ERβ cDNA was obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Biochemistry 2023Quote: ... and human CYB5R1-myc-DDK (OriGene RC205833L3) plasmids were transiently co-transfected into HEK293T cells using PolyFect (Qiagen 301105 ...
-
bioRxiv - Physiology 2019Quote: ... NRVMs (1 – 3 days post isolation) were transiently transfected with either variant 8 of human BIN1 (AmpII) (Origene Inc, USA) cloned into pCMV6-AC-mKate2 entry vector (Origene Inc ...
-
bioRxiv - Cancer Biology 2020Quote: The expression vector pCMV6-Entry-ETV7 C-terminally tagged with DDK-Myc tags was purchased from Origene (Tema Ricerca, Bologna, Italy). The lentiviral vector pAIP-ETV7 was obtained by cloning using the following primers to amplify the ETV7 gene from pCMV6-Entry-ETV7 and inserting it into the pAIP-Empty plasmid (the tails containing restriction endonucleases’ target sequences are indicated in lowercase):
-
bioRxiv - Cancer Biology 2020Quote: ... 3×104 HT29 cells and 3×105 Caco2 cells were seeded in 6-wells plates and transduced with the Human Tagged ORF Clone lentiviral particles containing the pLenti-C-mGFP-P2A-Puro vector fused to the CaSR gene (RC211229L4V, OriGene, USA) (HT29CaSR-GFP and Caco2CaSR-GFP) ...
-
bioRxiv - Microbiology 2024Quote: ... seed in a 6-well plate were transiently co-transfected with 200 ng of a myc-tagged FOS (pCMV6-FOS, OriGene, RC202597) and 600 ng of a wt ORF57 (pVM7 ...
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... The plasmid encoding human GLUT1 was from OriGene. The haemagglutinin (HA-)tag sequence atcgattatccttatgatgttcctgattatgctgag was inserted at base pair 201 (between amino acids 67 and 68 of the exofacial loop of GLUT1 ...
-
bioRxiv - Cell Biology 2019Quote: ... Human CD31 was obtained from Origene (TrueClone, SC119894). Piezo1 and CD31 pcDNA6 templates were generated by inverse PCR with the Phusion® DNA polymerase (New England Bio Labs) ...
-
bioRxiv - Neuroscience 2021Quote: ... and cDNA encoding human TTL (NP_714923, Origene #RC207805L2) was cloned in it for TTL expression ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human RIOK2-flag cDNAs encoding isoform I (Origene) were cloned into pRev-Tre tetracycline inducible vectors (Clontech) ...
-
bioRxiv - Neuroscience 2020Quote: The cDNA sequence of human GAPDH (OriGene, UK) was inserted into the pET-28b(+ ...
-
bioRxiv - Cancer Biology 2020Quote: ... TFE3 variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cancer Biology 2020Quote: ... human VDR transcript variant 2 cDNA (OriGene, RC519628) was transfected into the SKOV3 cells using Lipofectamine 2000TM (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... whereas the ORF encoding human p130 from Origene.
-
MIIP downregulation promotes colorectal cancer progression via inducing adjacent adipocytes browningbioRxiv - Cancer Biology 2023Quote: ... Human CD36 or control shRNA constructs (Origene, TR314090) were transfected into parental HCT116 cells using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... wells containing 2 µg of human PLG (Origene) were incubated with 3 µg of D-Val-Leu-Lys 4-nitroanilide dihydrochloride chromogenic substrate (S-2251 ...
-
bioRxiv - Immunology 2021Quote: ... The Emory University Integrated Genomics core facility (Atlanta, GA) subcloned mouse and human Esm-1 cDNA from pCMV6 (Origene, Rockville, MD) into pT3 ...
-
bioRxiv - Cancer Biology 2019Quote: For exogenous over-expression of CD82 and KDELR3 genes the following expression plasmids were used: CD82 transcript variant 1 (NM_002231) Human Untagged Clone (Origene, CAT#: SC324395), pCMV6-AC Tagged Cloning mammalian vector with non-tagged expression (Origene ...
-
bioRxiv - Cancer Biology 2021Quote: Cxcl5 (NM_009141) Mouse Tagged ORF Clone Lentiviral Particles containing 107 transduction units/ml were purchased from Origene (Cat no: MR200761L4V; Rockville, MD). 50 μl of lentiviral suspension was added to sub-confluent KRC line in a single well of a 24-well plate containing 200 μl of complete media ...
-
bioRxiv - Immunology 2023Quote: ... and either with a lentiviral expression vector carrying GFP-tagged MCEMP1 ORF or insertless (mock) vector for MCEMP1 overexpression (lentivirus were purchased from Origene, MD, USA). A MOI of 50 was necessary to achieve a satisfactory infection rate ...
-
bioRxiv - Cell Biology 2020Quote: ... or FLAG-mNUP153 (mouse) expression vectors were constructed by amplifying full length human NUP153 or mouse NUP153 cDNA using human NUP153 cDNA (Origene, SC116943) or mouse NUP143 cDNA (ATCC ...
-
bioRxiv - Physiology 2023Quote: ... The NAA10-Myc plasmid was constructed by subcloning of a Myc-His tag to replace the Myc-DDK tag in the hNAA10-Myc-DDK plasmid (RC201354, OriGene). The SIK3-Flag plasmid was constructed by subcloning of a 3xFlag tag to replace the Myc-DDK tag in the mSIK3-Myc-DDK plasmid (MR211912 ...