Labshake search
Citations for Origene Technologies :
201 - 249 of 249 citations for Mouse Short Coiled Coil Protein SCOC ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... Expression constructs encoding Myc-Flag-tagged (C- end) mouse CNNM1-4 and ARL15 in the pCMV6-Entry expression vector were acquired from OriGene (MR218318 for CNNM1 ...
-
bioRxiv - Cancer Biology 2021Quote: CT-2A and GL261 glioma cell lines were infected with Slit2 mouse shRNA lentiviral particles (Locus ID 20563, Origene TL511128V) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... The mouse Synaptophysin gene was cloned as a BamHI/NotI fragment into a modified pCMV6-AN-His vector (Origene, USA) that contains an N-terminal 12xHis tag followed by a PreScission cleavage site ...
-
bioRxiv - Cell Biology 2023Quote: ... PRB-114P) was from Covance. Mouse monoclonal anti-human JC (clone 3C7, aka OTI3C7) (cat. TA504168) was obtained from OriGene Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... The membranes were incubated with the following primary antibodies overnight at 4°C: mouse anti-DPP9 (Origene, TA503937, 1:1000). After three washes with TBST ...
-
bioRxiv - Genomics 2022Quote: ... sub-confluent human preadipocytes were transfected with 500ng ADGRG6 expression plasmid Myc-DDK-tagged human G protein-coupled receptor 126 (Origene, RC212889) using LipoMag transfection reagent and cells were then subjected to the adipocyte differentiation protocol described above.
-
bioRxiv - Pathology 2021Quote: ... Additional positive and negative control experiments were performed in which purified recombinant PBX1 and MEIS2 proteins (purchased from Origene, Rockville, MD) were incubated with the same concentrations of each drug and assayed.
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid pCMV6-AC-GFP-rtTA-APE1 (for WT tGFP-APE1 protein) was prepared by PCR full-length APE1 from pET28HIS-hAPE1 and subcloned into pCMV6-AC-GFP-rtTA vector (Origene #PS100125) at AscI and RsrII sites ...
-
bioRxiv - Cancer Biology 2020Quote: CRISPR/Cas9 knockout (KO) kit was purchased from Origene (KN206895) and cell lines were generated following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: A CRISPR knockout kit for Slc35a2 was obtained from OriGene. The plasmid in this kit (pCas-Guide-Slc35a2 ...
-
bioRxiv - Immunology 2021Quote: ... The Emory University Integrated Genomics core facility (Atlanta, GA) subcloned mouse and human Esm-1 cDNA from pCMV6 (Origene, Rockville, MD) into pT3 ...
-
bioRxiv - Developmental Biology 2022Quote: ... for testing were co-transfected with Renilla control plasmid (20 ng) and either a plasmid containing mouse Tbx1 cDNA (200 ng, Origene, PS100001) or empty vector control (200ng ...
-
bioRxiv - Cancer Biology 2023Quote: ... the slides were washed three times with PBS and incubated with secondary antibodies (hypersensitive enzyme-labeled goat anti-mouse/rabbit IgG polymer (OriGene, China) at room temperature for 20 min ...
-
bioRxiv - Cancer Biology 2019Quote: Recombinant Myc-Flag-RNF114 proteins were either purified from HEK292T cells as described above or purchased from Origene (Origene Technologies Inc., TP309752). For in vitro auto-ubiquitination assay ...
-
bioRxiv - Microbiology 2021Quote: ... MLV P30 protein within the pseudovirus capsid was detected using a rabbit anti-MLV-P30 polyclonal antibody (Origene, Cat. No. AP33447PU-N) and an HRP-conjugated goat anti-rabbit IgG Fc secondary antibody (Invitrogen ...
-
bioRxiv - Genomics 2023Quote: ... The oligoribonucleotides were incubated with either 10 µg HuR overexpressing HeLa cell whole cell extracts or 25-200 µM ELAVL1 human recombinant protein (Origene, Rockville, MD) in a 20 µL reaction mixture with 20 units of RNasin and 1X RNA binding buffer containing 20 mM HEPES (pH 7.6) ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized using the first-strand cDNA synthesis kit (Origene) with 1 μg of total RNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... reverse transcription was performed with First-strand cDNA Synthesis kit (OriGene). For RNA-seq ...
-
bioRxiv - Cancer Biology 2021Quote: Cxcl5 (NM_009141) Mouse Tagged ORF Clone Lentiviral Particles containing 107 transduction units/ml were purchased from Origene (Cat no: MR200761L4V; Rockville, MD). 50 μl of lentiviral suspension was added to sub-confluent KRC line in a single well of a 24-well plate containing 200 μl of complete media ...
-
bioRxiv - Immunology 2023Quote: Tissue paraffin sections were stained with H&E for histopathological evaluation or with biotinylated anti-mouse-IgG (Vector; BA-9200) for the detection of immune complex deposits and anti-human IL23A (OriGene; AM20386PU-N) for the detection of human IL23A protein in various tissues.
-
bioRxiv - Microbiology 2021Quote: ... The lentivirus contained the human ACE2 gene under control of the CMV promoter along with green fluorescent protein (GFP) also under control of a separate CMV promoter (Origene Technologies, Rockville, MD). A MOI of 20 was used for lentivirus transduction ...
-
bioRxiv - Neuroscience 2022Quote: ... Slices were then incubated with primary antibodies against green fluorescent protein (GFP, 1:500, Nacalai, 04404-84, RRID: AB_10013361) and tdTomato (1:500, OriGene, AB8181-200, RRID: AB_2722750) at room temperature for 2 h ...
-
bioRxiv - Immunology 2019Quote: Plasmids of the wild-type mouse Mul1 (pMul1-FLAG) and Asc (pAsc-Myc) were constructed using pCMV6 Mul1-Myc/DDK (MR205346, Origene, Rockville, MD, USA) and pcDNA3-N-FLAG-Asc (a gift from Bruce Beutler ...
-
bioRxiv - Molecular Biology 2020Quote: ... and a mouse monoclonal antibody OTI5F12 (likely an internal epitope since the full 479 aa sequence was used as an antigen; Origene Technologies, Rockville, MD) were used as capture antibodies for the enrichment of ERG protein from cell lysates (Figure 1B) ...
-
bioRxiv - Neuroscience 2021Quote: Membranes were blocked for 1 hour at room temperature with Odyssey blocking buffer (Li-Cor, Lincoln, NE, USA) and were then incubated with mouse anti-TurboGFP (1:2000; Origene, Rockville, MD, USA) and rabbit anti-β-tubulin (1:5000 ...
-
bioRxiv - Immunology 2020Quote: ... washing with PBST three times, mouse anti-HA-tag lgG2a mAb (4A.Biotech, 4ab000002, Beijing, China 1:1000) or lgG1 mAb (Origene, TA180128, USA, 1:2000) were added into each well (40 μl/well) ...
-
bioRxiv - Cancer Biology 2020Quote: ... we used NSMase2 (SMPD3) Human shRNA Plasmid Kit (Origene, Locus ID 55512), which included what we termed shSMPD3 variants A-D and shScr ...
-
bioRxiv - Cell Biology 2021Quote: The SacsJ cDNA (corresponding to residues 4316-4420) inserted in frame with GST into the pGEX6 vector was amplified from the mouse pEGFP-sacsin full length (OriGene Technologies, Rockville, MD, USA). For delivery into cells and tissues ...
-
bioRxiv - Cell Biology 2024Quote: The DNAJ cDNA (corresponding to residues 4316-4420 of sacsin) was subcloned using mouse pEGFP-sacsin full length cDNA (OriGene Technologies, Rockville, MD, USA) and inserted in frame with GST into the pGEX6 vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... The peroxidase reaction was developed with DAB kit (ZLI-9019, ORIGENE, Beijing, CHN) and the slides were counterstained with hematoxylin ...
-
bioRxiv - Cell Biology 2021Quote: ... and purified using PowerPrep HP Plasmid Maxiprep kits with prefilters (Origene, Rockville, MD). The SH-SY5Y neuroblastoma cells were transfected with 10 ug of plasmid DNAs when 60% confluence in 100-mm dishes using transfection reagents GenJet II (SignaGen Laboratories ...
-
bioRxiv - Biochemistry 2021Quote: ... MICS1KD cells were generated using the human shRNA plasmid kit for MICS1 (Origene, TR315671B) with the shRNA construct #1 (GGTCTTGGAGCATTCTGCTACTATGGCTT ...
-
bioRxiv - Cell Biology 2022Quote: ... Extracted RNA was converted to cDNA using the First Strand cDNA Synthesis kit (Origene) and then subjected to real time quantitative PCR using SYBR Green Master mix (BioRad ...
-
bioRxiv - Cancer Biology 2020Quote: ... The IFIH1 gene was deleted using a MDA5 (IFIH1) Human Gene Knockout Kit (OriGene, KN415661) according to the manufacturer’s instructions with target sequences (5’-CTGGATGTACATTTTCACCC-3’).
-
bioRxiv - Molecular Biology 2021Quote: ... CRISPR/Cas9 plasmid constructs were assembled using the pLenti-Cas-Guide construction Kit (GE100010, OriGene, Maryland, USA) and each sgRNA was ligated into the pLenti-Cas-sgRNA backbone as per the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... Transfections were performed using the Viromer Blue siRNA/miRNA transfection kit following the manufacturers’ instructions (Origene, Rockville, USA). Forty eight hours post siRNA treatment ...
-
bioRxiv - Cancer Biology 2023Quote: ... and packaging plasmids Lenti-vpak packaging kit with transfection reagent (TR30037) were purchased from OriGene (Rockville, MD, USA) and the experiments were conducted following the instruction of the kit.
-
bioRxiv - Cancer Biology 2020Quote: Control cell plugs were made by transfecting PC3 cells with C-kit Variant 1 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cancer Biology 2019Quote: Replication incompetent lentivirus were produced in HEK 293T cells co-transfected by mixing 5 µg of either pLKO.1 Empty Vector or pLKO.1 shRNA targeting SMARCD3 with 6 µg Lenti-vpak packaging kit components (OriGene) and 33 µL of transfection reagent (OriGene ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lentiviral particles were generated by co transfection in Lenti-X™ 293T cells (Takarabio) of lentiviral packaging kit (Origene) and plasmids for the expression of IL2-GFP+ ...
-
bioRxiv - Genetics 2022Quote: ... DAB staining was performed using Polink-2 Plus HRP Polymer and AP Polymer detection for Rb antibody kit (D39-18, Origene) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... Hepatocytes were transfected with 2.75 µM dsiRNA (Integrated DNA Technologies, Coralville, IA) in nuclease-free duplex buffer using the Viromer® Blue transfection kit (Origene) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: GCN2 and ATF4 knock-out cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5’-AATTTAGTTTTGTACCCTCA-3’ ...
-
bioRxiv - Neuroscience 2021Quote: siRNA mediated knockdown of Nt5c2 in rat primary cortical neurons was conducted using the Trilencer 27-mer NT5C2 siRNA kit (Origene: SR307908) at DIV15 per manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... Sections were then developed using the respective Polink-2 Plus HRP with DAB kit (Origene, D87-6 Hamster D39-6 Rabbit). Sections were counterstained in Hematoxylin (EMS ...
-
bioRxiv - Cell Biology 2023Quote: ... The manufacturer’s protocol was used for viral production by mixing pLenti-C-TAZ-mGFP-P2A-Puro with packaging plasmids and transfection reagent from the Lenti-vpak packaging kit (OriGene, Cat#TR30037). The mixture was transfected into HEK293T cells to generate pseudoviral particles ...
-
bioRxiv - Molecular Biology 2023Quote: ... staining was performed using Polink-2 Plus HRP Polymer and AP Polymer detection for Rb antibody kit (D39-18, Origene, Washington, USA) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: MDA-MB-231 shRNA cells were generated through lentiviral transduction using HuSH shRNA plasmid panels (29 mer) with pGFP-C-Lenti vectors and the Lenti-vpack Packaging Kit (TR30037) according to manufacturer guidelines (OriGene Technologies, Rockville, MD). shRNA plasmids included four LPL shRNAs and a negative control (TL311692) ...
-
bioRxiv - Microbiology 2021Quote: RNA interference for ATG5 and ATG7 in HepG2 cells was performed according to the protocol of ATG5/7 Human shRNA Plasmid Kits (Origene, Rockville, MD, USA). HepG2 cells (1 × 106 ...