Labshake search
Citations for Origene Technologies :
201 - 250 of 317 citations for Mouse Anti Nipah Virus Glycoprotein G CF12 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... rabbit anti-Spike MAb (Origene, Rockland, Maryland), diluted 1:250 ...
-
bioRxiv - Neuroscience 2023Quote: ... Anti-CSNK1G1 (IF: 1:50, OriGene, TA806333S); Anti-ROBO2 (IF ...
-
bioRxiv - Cell Biology 2023Quote: ... Anti-mCherry (Origene, Cat. No.: AB0040-200), Anti-calnexin (Abcam ...
-
bioRxiv - Genetics 2024Quote: ... anti-DNA-PK (1:4000, Origene #TA314389), anti-Rabbit-IgG (1:2000 ...
-
bioRxiv - Neuroscience 2020Quote: The plasmid encoding AAV-PGK-chst3 was made by amplifying the mouse chst3 sequence from plasmid MR207541 (OriGene) via the primers 5’ GGAATTCATAGGGCGGCCGGGAA 3’ and 5’ AGCGCTGGCCGGCCGTTTAAAC 3’ and was cloned into plasmid AAV-PGK-Cre (Addgene plasmid # 24593 ...
-
bioRxiv - Biochemistry 2021Quote: ... transiently co-transfected with pcDNA3.1-FIT2/V5-His and GFP-tagged MARCH6 (BC059190) Mouse Tagged ORF Clone (Origene), were pre-treated with 10 µM MG132 (Cell Signaling Technology ...
-
bioRxiv - Molecular Biology 2020Quote: The mouse YAP1 WT gene with a Myc-tag in the pCMV6 backbone was purchased from Origene (MR226049). YAP S274A and YAP S352A mutants were generated by PCR assembly ...
-
bioRxiv - Molecular Biology 2022Quote: H9c2 cells were transfected with plasmid containing DDK-tagged mouse JCN (Accession number: NM_133723, Origene, Rockville, MD, USA) or its mutant (K8R/K102R/K107R/K140R ...
-
bioRxiv - Biophysics 2024Quote: The mouse LRMP construct in PCMV6-Kan/Neo (GenBank AAH52909.1; Cat. #MC228229, Origene, Rockville, MD; Supplementary Figure 1), HCN1 in pcDNA3 (generously provided by Dr ...
-
bioRxiv - Cell Biology 2020Quote: ... the anti-TFAM (TA332462, rabbit; Origene, Rockville, USA) antibody was incubated in 5 molar excess of NHS-Alexa Fluor 546 (A20002 ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-RFP (1:1000, OriGene, AP09229PU-N), guinea pig anti-pSmad1/5/8 (1:300 ...
-
bioRxiv - Cell Biology 2021Quote: ... respectively): anti-SKAP (1ug/ml, rabbit, Origene, TA333584), anti-α-tubulin (DM1A ...
-
bioRxiv - Cancer Biology 2021Quote: ... the anti-MYC antibody 9E10 was from Origene, the anti-Strep-tag antibody from Biorad ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1:1000 Anti-DDK (FLAG) Clone 4C5 (OriGene Cat# TA50011-100 ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-ALPPL2 affinity-purified rabbit polyclonal antibody (Origene) or anti-ALPPL2 mouse antibody (Clone SPM593 ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-GFP rabbit polyclonal (Origene, TA150032, 1:10,000), anti-HA mouse monoclonal (BioLegend ...
-
bioRxiv - Neuroscience 2021Quote: ... and anti-TUBB3 (Origene, TA500047, 1:3,000 dilution), anti-GAPDH conjugated peroxidase (Proteintech ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-NOB1 (1:1000, Origene TA808793 clone OTI1C12), anti-phospho-Ser/Thr-Pro MPM-2 (1:500 ...
-
bioRxiv - Biochemistry 2023Quote: ... and rabbit anti-mKate2 antibodies (1:2000, Origene). The protein bands were obtained using horseradish peroxidase-conjugated antibodies against mouse whole immunoglobulins and horseradish peroxidase-conjugated antibodies against rabbit whole immunoglobulins (1∶10,000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and Goat anti-Tdtomato (Origene AB8181; 1:500).
-
bioRxiv - Neuroscience 2020Quote: Stable cell lines were generated in HEK293 (ATCC, mycoplasma free) using a pCMV vector expressing either 1µg of mouse or human TRPC5 (Origene) co-transfected with 7µg of pBabe Puro vector for rapid stable selection ...
-
bioRxiv - Biochemistry 2020Quote: ... the mGFP cDNA was inserted between the region encoding the 71st and 82nd amino acids of mouse Gαs (Origene) in the pcDNA3.1 (+ ...
-
bioRxiv - Neuroscience 2021Quote: ... SP6 transcribed antisense and T7 transcribed sense control probes were synthesized from mouse Fcgr1 (NM_010186) cDNA clone (MR225268, OriGene) using 1 set of primers (forward ...
-
bioRxiv - Biochemistry 2021Quote: ... The eluted fraction was then subjected to immunoblotting assay and MARCH6 was detected using Mouse monoclonal turboGFP antibody (Origene).
-
bioRxiv - Physiology 2022Quote: ... coated 6-well plates (SPL Life Sciences Co., Korea) with Kcnq4 Mouse Tagged ORF Clone (OriGene, Rockville, MD, USA) using Lipofectamine LTX and Plus Reagents (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... PVDF membranes were incubated with the indicated primary antibodies (anti-HA: Cell Signaling Technology, C29F4, Rabbit mAb CAT#: 3724, 1:1000; anti-FLAG: Origene, mouse monoclonal antibody ...
-
bioRxiv - Cell Biology 2020Quote: ... Overexpressed HA-NFATc3 and endogenous Trim39 were detected using anti-HA (1:500) and anti-Trim39 (from Proteintech 1:200, from Origene 1:400) antibodies respectively ...
-
bioRxiv - Cell Biology 2019Quote: ... and shRNAs against mouse DNMBP cloned into the pRFP-C-RS vector (TF515449, Locus ID 71972) were purchased from OriGene. Cdc42F28L-HA was provided by Richard A ...
-
bioRxiv - Immunology 2021Quote: The pCMV6-Ac-GFP vector containing the mouse Mt3 gene (pCMV6-Ac-MT3-GFP) and empty pCMV6-Ac-GFP vectors were acquired from Origene and dissolved in nuclease-free sterile H2O ...
-
bioRxiv - Genetics 2022Quote: ... and for WDR60p.Ala911Val mutant cells were transfected with WDR60 Mouse Myc-DDK-tagged tagged ORF Clone (MR217536, Origene, Maryland, USA). After 24 h cells were treated with 10µM monensin and immunofluorescence analysis was done as explained above ...
-
bioRxiv - Cell Biology 2020Quote: A non-tagged construct of mouse Gdf3 was generated using the commercial vector pCMV6-Gdf3-Myc-Flag (OriGene Technologies, MR222967), containing a Myc-Flag-tagged Gdf3 ...
-
bioRxiv - Biochemistry 2021Quote: ... Expression constructs encoding Myc-Flag-tagged (C- end) mouse CNNM1-4 and ARL15 in the pCMV6-Entry expression vector were acquired from OriGene (MR218318 for CNNM1 ...
-
bioRxiv - Cancer Biology 2021Quote: CT-2A and GL261 glioma cell lines were infected with Slit2 mouse shRNA lentiviral particles (Locus ID 20563, Origene TL511128V) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... The mouse Synaptophysin gene was cloned as a BamHI/NotI fragment into a modified pCMV6-AN-His vector (Origene, USA) that contains an N-terminal 12xHis tag followed by a PreScission cleavage site ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP was detected using anti-GFP antisera (TP401, OriGene).
-
bioRxiv - Immunology 2021Quote: ... Rabbit polyclonal anti-CCL5 antibody (Origene Cat# PP1081P1, RRID:AB_1006884) was used for the neutralization of CCL5 chemokine.
-
bioRxiv - Biochemistry 2022Quote: ... and the other with anti-METTL7A primary antibody (Origene, Rockville MD ...
-
bioRxiv - Molecular Biology 2019Quote: ... The antibodies used include: anti-turboGFP (Origene, cat # TA150041), -PDHA1 (Cell Signaling Technology ...
-
bioRxiv - Biochemistry 2019Quote: ... anti-Lupus La #TA-00406 (Origene Technologies, Rockville, MD), anti-vinculin #ab129002 (Abcam) ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit polyclonal anti-GABRA5 (1:200, Origene Cat# TA338505), guinea pig polyclonal anti-GAD2 (1:200 ...
-
bioRxiv - Immunology 2021Quote: ... The Emory University Integrated Genomics core facility (Atlanta, GA) subcloned mouse and human Esm-1 cDNA from pCMV6 (Origene, Rockville, MD) into pT3 ...
-
bioRxiv - Developmental Biology 2022Quote: ... for testing were co-transfected with Renilla control plasmid (20 ng) and either a plasmid containing mouse Tbx1 cDNA (200 ng, Origene, PS100001) or empty vector control (200ng ...
-
bioRxiv - Microbiology 2021Quote: ... Primary antibodies against SC2 included rabbit anti-Nucleoprotein MAb (Origene) and rabbit anti-Spike MAb (Origene) ...
-
bioRxiv - Cell Biology 2021Quote: ... and anti-Rab IgG secondary rabbit antibody (OriGene Technologies, U.S.) were diluted at 1:5000 for incubation with the membrane ...
-
bioRxiv - Neuroscience 2020Quote: ... or Guinea Pig anti-CK20 (Origene Tech, Germany, 1:200). Secondary antibodies used were anti-rabbit Alexa Fluor 488 ...
-
bioRxiv - Cancer Biology 2019Quote: ... and polyclonal anti-rabbit IgG (1:5000, R1364HRP, OriGene, Germany). Proteins were detected using chemiluminescence HRP substrate (Merck) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... rabbit anti-EMX1 (Origene, TA325087, WB 1:1000 in BSA), rabbit anti-BLBP (Abcam ...
-
bioRxiv - Biochemistry 2021Quote: ... anti-SARS-CoV-2 Spike Protein was purchased from Origene Technologies Inc ...
-
bioRxiv - Immunology 2020Quote: ... and rabbit anti-CCR7 polyclonal antibody (TA310252, Origene, Rockville, MD). The secondary antibodies were FITC- ...
-
bioRxiv - Neuroscience 2022Quote: ... and b) rabbit polyclonal anti-GLP-1R (1:50; Origene) and mouse monoclonal anti-GFAP antibody (1:500 ...