Labshake search
Citations for Origene Technologies :
151 - 200 of 403 citations for Siglec 5 Human HEK293 His Flag Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... overnight at 4°C (anti-PsbA; AS05 084A; anti-PsaB; AS10 695; anti-APC; AS08 277; Agrisera, anti-His tag; TA150087; OriGene). The membrane was washed 3 times in TBST-T at room temperature for 15 minutes each wash followed by incubation with secondary polyclonal anti-rabbit antisera HRP for one hour at room temperature in TBS-T (Jackson ImmunoResearch ...
-
bioRxiv - Neuroscience 2023Quote: 5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
bioRxiv - Cell Biology 2022Quote: ... A plasmid coding for expression of Flag-HA-mNeonGreen-tagged MmULK4 (cDNA: Origene, MR217918; mNeonGreen (mNG) was provided by Allele Biotechnology and Pharmaceuticals (Shaner et al ...
-
bioRxiv - Cell Biology 2021Quote: ... Germany 64) and 1.5 µg or 2.0 µg pCMV6-Myc-FLAG-GINS1 (OriGene Technologies, Inc., USA), respectively ...
-
bioRxiv - Physiology 2021Quote: ... with a myc-FLAG epitope tag on the C-terminus (MR223526, Origene Technologies, Rockville, MD, USA). The human full-length BACE1 or BACE2 cDNAs were expressed from the pcDNA3.1/myc-His expression vector (Invitrogen ...
-
Proteasomal degradation of human SERINC4: a potent host anti-HIV-1 factor that is antagonized by NefbioRxiv - Microbiology 2020Quote: ... and Ser5 and murine Ser4 that express a C-terminal FLAG tag were purchased from Origene, and the Ser1 ...
-
bioRxiv - Immunology 2023Quote: ... tagged ADA2 was pulled down using 1 µg anti-DDK (FLAG) clone OTI4C5 (#TA50011, OriGene Technologies). An isotype control sample was incubated with 1 µg mouse IgG1 (#02-6100 ...
-
bioRxiv - Neuroscience 2022Quote: Plasmid constructs overexpressing Myc-ddk tagged wild-type human α-syn (Myc-α-synuclein) and Myc-ddk tagged wild-type human UBA52 (Myc-UBA52) were purchased from Origene technologies ...
-
bioRxiv - Microbiology 2023Quote: AREG: 5’-GCACCTGGAAGCAGTAACATGC-3’ (Fwd) and 5’-GGCAGCTATGGCTGCTAATGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD3: 5’-AGGCAGTAGATGTGCGCCAGAT-3’ (Fwd) and 5’-TCCTGGATGGTGCTGTTGAGGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD1: 5’-CCTGGCTATCTATCCACCATGTG-3’ (Fwd) and 5’-TTCTGGTCCTCGTCTTGCCTGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9L: 5’-CCGCTCTACCACAATGCCATCA-3’ (Fwd) and 5’-CTGAGTTCAGGTGCATCTGGCT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: AMOTL2: 5’-AGTGAGCGACAAACAGCAGACG-3’ (Fwd) and 5’-ATCTCTGCTCCCGTGTTTGGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9: 5’-TCCAGCTCGTTCTCCCAACTTG-3’ (Fwd) and 5’-GATTGGAGTGAGAAAGTGGCTGG-3’ (Rev) (sequences from Origene)
-
bioRxiv - Microbiology 2023Quote: RPLP0: 5’-TGGTCATCCAGCAGGTGTTCGA-3’ (Fwd) and 5’-ACAGACACTGGCAACATTGCGG-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: PYGO1: 5’-GGTTAGGAGGACCAGGTGTACA-3’ (Fwd) and 5’-AGCAGCCACTAGATGGTCAGAG-3’ (Rev) (sequences from Origene)
-
bioRxiv - Biophysics 2019Quote: ... Human mitofusin 1-GFP was purchased from OriGene (#RG207184).
-
bioRxiv - Molecular Biology 2020Quote: 200 ng of recombinant human Cdt1 (OriGene, Cat #: TP301657) and 20 ng of purified Cyclin A/Cdk1 (Sigma cat ...
-
bioRxiv - Neuroscience 2022Quote: A plasmid encoding human TrkB was purchased from OriGene Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... Human Cx32 and Rhodopsin cDNA was obtained from Origene and cloned into a pSVL vector (Amersham) ...
-
bioRxiv - Cancer Biology 2021Quote: Human LDHA plasmid was purchased from Origene (MD, USA). Succinylation mutants of LDHA were generated using site-directed mutagenesis kit (GeneAll ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant human PIAS4 was purchased from OriGene (Cat. # TP306748). Recombinant human SUMO-1 and SUMO-2 were purchased from R&D systems (Cat ...
-
bioRxiv - Cancer Biology 2020Quote: ... C-kit Variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Immunology 2020Quote: ... HEK293T cells stably expressing GFP-tagged human ACE2 (Origene) were generated using the same methodology ...
-
bioRxiv - Neuroscience 2023Quote: ... Human Adgrd1 cDNA was obtained from Origene (Cat: PS100001). Generation of Adgrd1 N-terminal mutations was carried out using Q5 site directed mutagenesis kit (NE Biolabs ...
-
bioRxiv - Biophysics 2023Quote: ... the cDNA encoding for human TMEM115 (Origene cat# RG203956) was cloned into pEGFP-C1 using NheI and BsrGI restriction sites ...
-
bioRxiv - Molecular Biology 2022Quote: The plasmid pCMV6-UBE2M-Myc-DDK (DDK is the same as FLAG®) was obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-cleaved Caspase-3 (9661S, CST, 1:500) and anti-Flag (TA-50011-100; Origene, 1:500). Cells were washed with PBS and incubated with secondary antibodies (Jackson Immunoresearch Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... and p62 T269E/S272D-3x Flag were cloned into pLenti-C-Myc-DDK-IRES-Neo vector (Origene) using NEBuilder® HiFi DNA Assembly Master Mix per manufacturer’s instructions (New England BioLabs ...
-
bioRxiv - Cell Biology 2023Quote: A Myc-DDK (FLAG)-tagged coding DNA sequence (CDS) clone of murine Runx2 was purchased from Origene within the pCMV-ENTRY overexpression vector (catalogue number MR227321) ...
-
bioRxiv - Biochemistry 2023Quote: HCT116 TP53(-/-) cells were transfected with a FLAG-tagged RIG-I expression vector purchased from Origene (RC217615) using Lipofectamine 3000 in six 150 mm dishes plated to 90% confluency the day before ...
-
bioRxiv - Biochemistry 2023Quote: Myc-DDK-tagged lenti ORF clone of c1orf112 (Lenti-Myc-FLAG-RADIF) was obtained from Origene (RC211444L1). Human FIGNL1 sequence-verified cDNA (FIGNL1-cDNA ...
-
bioRxiv - Immunology 2022Quote: ... Plasmid containing human IL-12p35 cDNAs were obtained from Origene. One day before transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNA of human FIP200 was purchased from OriGene (SC114884), pmCherry_Gal3 was a gift from Hemmo Meyer (Addgene plasmid #85662 ...
-
bioRxiv - Microbiology 2021Quote: ... A soluble fragment of human LAMP1 was obtained from Origene Protein (Cat# TP720784) ...
-
bioRxiv - Cell Biology 2021Quote: ... and human normal brain tissue qPCR array (OriGene Technologies, HBRT101) were used ...
-
bioRxiv - Molecular Biology 2022Quote: STAT1 human siRNA Oligo Duplex and nontargeting scramble siRNA (Origene) were transiently transfected in the MCF7 cells ...
-
bioRxiv - Bioengineering 2022Quote: Full-length human LRP6 was cloned into pCMV-Entry (Origene) and used for sub-cloning ...
-
bioRxiv - Immunology 2022Quote: The human Myc-NEU3 expression plasmid RC216537 (Origene, Rockville, MD) was used to express NEU3 ...
-
bioRxiv - Zoology 2023Quote: ... an empty vector or human MD-2 (OriGene, cat. #RC204686) were transiently expressed ...
-
bioRxiv - Cancer Biology 2023Quote: ... The TGF beta 1 (NM_000660) Human Untagged Clone (Origene, SC119746) was used to perform site-directed mutagenesis on residues C355 ...
-
bioRxiv - Physiology 2023Quote: ... Rabbit polyclonal anti-human C12orf23 (TMEM263) was from Origene (TA333490). Mouse monoclonal JAK2 (C-10) ...
-
bioRxiv - Immunology 2020Quote: ... 0.1ug of sequence-verified pCMV-insert-MYC-FLAG overexpression vectors containing either no insert (Origene #PS100001; ‘mock’ transfection) or RFX6 insert (Origene #RC206174 ...
-
bioRxiv - Cell Biology 2020Quote: ... 293T cells were co-trasfected with 1μg per well of 6-well plate of either pCAGGS/GST or pCAGGS/GSTVPS28 and with with 1μg per well of 6-well plate of pCMV6-Entry-AKTIP-Myc-Flag (ORIGENE) or with 1μg per well of 6-well plate of AKTIP-HA (pCR3.1 ...
-
bioRxiv - Cell Biology 2022Quote: 70% confluent HEK293T cells were transfected with Flag-tagged Mena in pcDNA3.1+/C-(K)DYK (obtained from Origene; Omu14068c) using calcium phosphate-based transfection ...
-
bioRxiv - Immunology 2019Quote: ... 31) and myc-FLAG-tagged Syncytin-1 and 2 expression constructs in the pCMV6 vector were purchased from Origene. pFR-Luc and pBD-NFkB (Agilent ...
-
bioRxiv - Genetics 2020Quote: ... GJB2 (NM_004004) Human Tagged ORF Clone was purchased from OriGene (RC202092) and Cx30-msfGFP was purchased from Addgene (69019).
-
bioRxiv - Bioengineering 2022Quote: Human GDNF cDNA (NM_199234) was provided by OriGene (Rockville, MD, USA) that was propagated in DH5α E.coli ...
-
bioRxiv - Developmental Biology 2022Quote: A panel of 20 normal human tissues was purchased from OriGene Technologies (Rockville ...
-
bioRxiv - Immunology 2020Quote: ... The human pCMV6-AC-AQP9-GFP expression vector was from Origene. 30% H2O2 solution ...