Labshake search
Citations for Origene Technologies :
151 - 200 of 651 citations for Mouse Anti Human Immunodeficiency Virus HIV 1 p17 1981 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Human Plaat cDNAs were purchased from ORIGENE [RC208444 for PLAAT1 (NM_020386) ...
-
bioRxiv - Neuroscience 2021Quote: Human cDNA panels were obtained from Origene: TissueScan ...
-
bioRxiv - Biochemistry 2021Quote: ... Human ERβ cDNA was obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Biochemistry 2023Quote: ... and human CYB5R1-myc-DDK (OriGene RC205833L3) plasmids were transiently co-transfected into HEK293T cells using PolyFect (Qiagen 301105 ...
-
bioRxiv - Biochemistry 2023Quote: ... Recombinant pure human 14-3-3σ (Origene) or mutations [12] (0.5 µg) ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse monoclonal antibody directed against α1-actinin (#TA500072S, IF dilution 1:100) was from Origene. Phalloidin-Alexa488 ...
-
bioRxiv - Cancer Biology 2020Quote: ... A primary mouse monoclonal Lysyl Hydroxylase 2 (LH2) antibody (Origene; Cat# TA803224, dilution 1:150) was used for the immunohistochemical staining.
-
bioRxiv - Neuroscience 2022Quote: ... rabbit polyclonal anti-GABRA5 (1:200, Origene Cat# TA338505), guinea pig polyclonal anti-GAD2 (1:200 ...
-
bioRxiv - Physiology 2019Quote: ... NRVMs (1 – 3 days post isolation) were transiently transfected with either variant 8 of human BIN1 (AmpII) (Origene Inc, USA) cloned into pCMV6-AC-mKate2 entry vector (Origene Inc ...
-
bioRxiv - Molecular Biology 2022Quote: ... or mouse MSS51-Myc-FLAG (mouse cDNA clone; Origene MR217897) using Lipofectamine 2000 as per manufacturer’s instructions ...
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... The plasmid encoding human GLUT1 was from OriGene. The haemagglutinin (HA-)tag sequence atcgattatccttatgatgttcctgattatgctgag was inserted at base pair 201 (between amino acids 67 and 68 of the exofacial loop of GLUT1 ...
-
bioRxiv - Cell Biology 2019Quote: ... Human CD31 was obtained from Origene (TrueClone, SC119894). Piezo1 and CD31 pcDNA6 templates were generated by inverse PCR with the Phusion® DNA polymerase (New England Bio Labs) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Recombinant pure human proteins were purchased from Origene. Pure proteins (0.1 μg ...
-
bioRxiv - Cell Biology 2020Quote: ... beta actin (NM_001101) human recombinant protein (Origene, TP720518).
-
bioRxiv - Cell Biology 2020Quote: ... beta actin (NM_001101) human recombinant protein (Origene, TP303643), beta actin (NM_001101 ...
-
bioRxiv - Neuroscience 2021Quote: ... and cDNA encoding human TTL (NP_714923, Origene #RC207805L2) was cloned in it for TTL expression ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human RIOK2-flag cDNAs encoding isoform I (Origene) were cloned into pRev-Tre tetracycline inducible vectors (Clontech) ...
-
bioRxiv - Neuroscience 2020Quote: The cDNA sequence of human GAPDH (OriGene, UK) was inserted into the pET-28b(+ ...
-
bioRxiv - Cancer Biology 2020Quote: ... TFE3 variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cancer Biology 2020Quote: ... human VDR transcript variant 2 cDNA (OriGene, RC519628) was transfected into the SKOV3 cells using Lipofectamine 2000TM (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... whereas the ORF encoding human p130 from Origene.
-
MIIP downregulation promotes colorectal cancer progression via inducing adjacent adipocytes browningbioRxiv - Cancer Biology 2023Quote: ... Human CD36 or control shRNA constructs (Origene, TR314090) were transfected into parental HCT116 cells using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... wells containing 2 µg of human PLG (Origene) were incubated with 3 µg of D-Val-Leu-Lys 4-nitroanilide dihydrochloride chromogenic substrate (S-2251 ...
-
bioRxiv - Neuroscience 2020Quote: Neurons were transfected at 12 days in vitro (DIV) with PSD95-GFP (a kind gift from David Bredt [49] and FLAG-tagged Human SRXN-1 (purchased from Origene: RC207654) for 5 h using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Cancer Biology 2019Quote: For exogenous over-expression of CD82 and KDELR3 genes the following expression plasmids were used: CD82 transcript variant 1 (NM_002231) Human Untagged Clone (Origene, CAT#: SC324395), pCMV6-AC Tagged Cloning mammalian vector with non-tagged expression (Origene ...
-
bioRxiv - Neuroscience 2020Quote: ... or Guinea Pig anti-CK20 (Origene Tech, Germany, 1:200). Secondary antibodies used were anti-rabbit Alexa Fluor 488 ...
-
bioRxiv - Cancer Biology 2019Quote: ... and polyclonal anti-rabbit IgG (1:5000, R1364HRP, OriGene, Germany). Proteins were detected using chemiluminescence HRP substrate (Merck) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... rabbit anti-EMX1 (Origene, TA325087, WB 1:1000 in BSA), rabbit anti-BLBP (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... and b) rabbit polyclonal anti-GLP-1R (1:50; Origene) and mouse monoclonal anti-GFAP antibody (1:500 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-GAPDH antibody (TA802519) is from Origene (WB-1:5000), anti-HA antibody (C29F4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... or 1 μg of anti-flag (α-DDK, TA50011, Origene) in 1 ml of lysis buffer containing 1 mg of total protein extract ...
-
bioRxiv - Genomics 2022Quote: ... sub-confluent human preadipocytes were transfected with 500ng ADGRG6 expression plasmid Myc-DDK-tagged human G protein-coupled receptor 126 (Origene, RC212889) using LipoMag transfection reagent and cells were then subjected to the adipocyte differentiation protocol described above.
-
bioRxiv - Neuroscience 2022Quote: Plasmid constructs overexpressing Myc-ddk tagged wild-type human α-syn (Myc-α-synuclein) and Myc-ddk tagged wild-type human UBA52 (Myc-UBA52) were purchased from Origene technologies ...
-
bioRxiv - Molecular Biology 2020Quote: 200 ng of recombinant human Cdt1 (OriGene, Cat #: TP301657) and 20 ng of purified Cyclin A/Cdk1 (Sigma cat ...
-
bioRxiv - Neuroscience 2020Quote: ... human Arcn1 with Myc and Flag tags (RC210778, Origene), Flag-APP-C99 was a kind gift from Wenjie Luo (Weill Cornell Medical College) ...
-
bioRxiv - Neuroscience 2022Quote: A plasmid encoding human TrkB was purchased from OriGene Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... Human Cx32 and Rhodopsin cDNA was obtained from Origene and cloned into a pSVL vector (Amersham) ...
-
bioRxiv - Cancer Biology 2021Quote: Human LDHA plasmid was purchased from Origene (MD, USA). Succinylation mutants of LDHA were generated using site-directed mutagenesis kit (GeneAll ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant human PIAS4 was purchased from OriGene (Cat. # TP306748). Recombinant human SUMO-1 and SUMO-2 were purchased from R&D systems (Cat ...
-
bioRxiv - Cancer Biology 2020Quote: ... C-kit Variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Immunology 2020Quote: ... HEK293T cells stably expressing GFP-tagged human ACE2 (Origene) were generated using the same methodology ...
-
bioRxiv - Neuroscience 2023Quote: ... Human Adgrd1 cDNA was obtained from Origene (Cat: PS100001). Generation of Adgrd1 N-terminal mutations was carried out using Q5 site directed mutagenesis kit (NE Biolabs ...
-
bioRxiv - Biophysics 2023Quote: ... the cDNA encoding for human TMEM115 (Origene cat# RG203956) was cloned into pEGFP-C1 using NheI and BsrGI restriction sites ...
-
bioRxiv - Molecular Biology 2024Quote: ... FLAG-tagged human angiogenin plasmid (hANG) (OriGene, Cat# RC208874) and Mock plasmid were transiently transfected according to the manufacturer’s protocol into HEK293T cells in full growth medium using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2023Quote: ... SMCs were stained with anti-ZC3HC1 (Origene, AP20366PU-N, 1:100), anti-Tubulin (abcam ...
-
bioRxiv - Cell Biology 2021Quote: Mouse Igfbp3 cDNA (Origene) was amplified with attB-containing primers and cloned into pDONR 221 (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse PRRX1 (Origene TA803116), rabbit YAP (Cell Signaling 14074) ...
-
bioRxiv - Biophysics 2024Quote: The mouse LRMP construct in PCMV6-Kan/Neo (GenBank AAH52909.1; Cat. #MC228229, Origene, Rockville, MD; Supplementary Figure 1), HCN1 in pcDNA3 (generously provided by Dr ...
-
bioRxiv - Immunology 2022Quote: ... Plasmid containing human IL-12p35 cDNAs were obtained from Origene. One day before transfection ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLAG-tagged human angiogenin plasmid (Cat# RC208874; OriGene; Rockville, MD), GFP-tagged rat RNH1 plasmid (Cat# ORa42809C ...