Labshake search
Citations for Origene Technologies :
151 - 200 of 552 citations for Human LACC1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... CXCR4 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Biochemistry 2022Quote: ... human testis FFPE tissue (Origene, CB811079) was first sliced ...
-
bioRxiv - Cell Biology 2021Quote: ... or human GPR87 ORF (Origene, RC218486L3)) for 6 hrs ...
-
bioRxiv - Cancer Biology 2021Quote: ... and human IL-1β (Origene #RC202079L4) plasmid constructs were used for generating stable LNCaP cells ...
-
bioRxiv - Cell Biology 2023Quote: ... and Human MTERF (MTERF1) (Origene, TP761846). Proteins injected were serially diluted (two-fold each step ...
-
bioRxiv - Neuroscience 2023Quote: The human GPR37L1 cDNA clone (Origene) was subcloned into pcDNA3.1+ (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: Human CYP4F2-myc-DDK (OriGene RC216427), human
-
bioRxiv - Physiology 2023Quote: Human SLC8B1 cDNA (Origene #RC214624; NM_024959) was PCR amplified using primers to introduce a 5′ AgeI restriction site and a 3′ BamHI restriction site flanking the coding sequence ...
-
bioRxiv - Cell Biology 2023Quote: ... and Human Dlk2 pCMV6 (RC210622, Origene) vectors ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified human recombinant NRXN3 TP323448 (Origene) was used as standard ...
-
bioRxiv - Cancer Biology 2020Quote: ... PNT1A-HIP1 cells transfected with plasmid expressing scrambled hairpin RNA (Origene, HuSH pRS plasmids #TR312457) supplied within the same kit ...
-
bioRxiv - Immunology 2023Quote: Bone marrow cells from the femurs of LB2 mice were isolated and transduced with either scrambled or Annexin A1 (Anxa1) shRNA using TR30030 pRFP-C-shLenti vector (Origene Technologies Inc. MD, USA) at an MOI of 150 ...
-
bioRxiv - Cell Biology 2023Quote: ... a combination of four unique 29mer pRFP-C-RS-FHDC1 short hairpin RNA (shRNA) constructs (TF705017A, B, C, D, OriGene Technologies Inc, Rockville, MD) was introduced into the cells ...
-
bioRxiv - Developmental Biology 2020Quote: ... Each guide RNA was cloned into a plasmid containing Cas9-GFP (OriGene plasmid GE100018, Rockville, MD). Paired guide-RNA plasmids were transfected into ESCs using FUGENE 6 (Roche ...
-
bioRxiv - Cancer Biology 2022Quote: ... A CREBBP plasmid (NM_004380) and the corresponding EV Control plasmid was ordered from Origene (Rockland, MD). EP300 siRNA (siEP300_1 ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293T cells were transfected with lentiviral plasmids and the appropriate packaging plasmids using turbofectamine (Origene, TR30037) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: The Gpr183 expression plasmid (Origene MR205447) was used as the wildtype control and underwent site-directed mutagenesis ...
-
bioRxiv - Neuroscience 2020Quote: ... GFP plasmids were obtained from Origene and Lonza ...
-
bioRxiv - Cancer Biology 2022Quote: ... and GCLC overexpressing plasmid (Origene, MC203908) were used ...
-
bioRxiv - Pathology 2021Quote: ... HMGB1 plasmid was purchased from Origene. 24h after transfection ...
-
bioRxiv - Biochemistry 2022Quote: ... Plasmids containing OGA (Origene cat # RC222411) or OGT (Origene cat # RC224481 ...
-
bioRxiv - Neuroscience 2023Quote: ... ZBTB7A overexpression plasmids (Origene Cat. #RC222759) were cloned into either a Lentiviral CMV-driven construct for use in cell culture experiments (shown in Figure S2 ...
-
bioRxiv - Cell Biology 2021Quote: ... Human Plaat cDNAs were purchased from ORIGENE [RC208444 for PLAAT1 (NM_020386) ...
-
bioRxiv - Neuroscience 2021Quote: Human cDNA panels were obtained from Origene: TissueScan ...
-
bioRxiv - Biochemistry 2021Quote: ... Human ERβ cDNA was obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Biochemistry 2023Quote: ... and human CYB5R1-myc-DDK (OriGene RC205833L3) plasmids were transiently co-transfected into HEK293T cells using PolyFect (Qiagen 301105 ...
-
bioRxiv - Biochemistry 2023Quote: ... Recombinant pure human 14-3-3σ (Origene) or mutations [12] (0.5 µg) ...
-
bioRxiv - Neuroscience 2023Quote: ... we used a plasmid containing SNX27-FLAG under CMV promoter (pCMV-SNX27-FLAG, OriGene Technologies plasmid #MR218832). For SNX27 knockdown experiments ...
-
bioRxiv - Neuroscience 2020Quote: The plasmid encoding AAV-PGK-chst3 was made by amplifying the mouse chst3 sequence from plasmid MR207541 (OriGene) via the primers 5’ GGAATTCATAGGGCGGCCGGGAA 3’ and 5’ AGCGCTGGCCGGCCGTTTAAAC 3’ and was cloned into plasmid AAV-PGK-Cre (Addgene plasmid # 24593 ...
-
bioRxiv - Genomics 2024Quote: ... cells were transfected with 300 ng of each sgRNA-15xPBS plasmid and 40 ng of each fluorescent protein plasmid using 3.5 µL TurboFectin 8.0 (OriGene). Media was changed at 24 hours post-transfection.
-
bioRxiv - Biochemistry 2020Quote: ... Plasmids GCK (MSP4K2) (cat. no. RC200472, OriGene), HGK (MAP4K4 ...
-
bioRxiv - Neuroscience 2020Quote: ... and Nup98 plasmids were obtained from Origene. Additional POM121 and sPOM121 plasmids (Franks et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmids harboring C-terminally Flag-tagged wild-type or mutant human TDP-43 and p38α sequences in the pcDNA3.1+/C-(K)-DYK mammalian expression vector were purchased from Genscript and PRMT1 plasmid was purchased from Origene. TDP-43 bacterial expression vector harboring a C-terminal MBP tag (pJ4M TDP-43-TEV-MBP-6xHis ...
-
bioRxiv - Neuroscience 2021Quote: ... lentiviral expression plasmid pSKAP2-mGFP (Origene #MR205468L2) was used.
-
bioRxiv - Cancer Biology 2024Quote: Viral vector plasmids were obtained from OriGene Technologies ...
-
bioRxiv - Cell Biology 2019Quote: ... Human CD31 was obtained from Origene (TrueClone, SC119894). Piezo1 and CD31 pcDNA6 templates were generated by inverse PCR with the Phusion® DNA polymerase (New England Bio Labs) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Recombinant pure human proteins were purchased from Origene. Pure proteins (0.1 μg ...
-
bioRxiv - Cell Biology 2020Quote: ... beta actin (NM_001101) human recombinant protein (Origene, TP720518).
-
bioRxiv - Cell Biology 2020Quote: ... beta actin (NM_001101) human recombinant protein (Origene, TP303643), beta actin (NM_001101 ...
-
bioRxiv - Neuroscience 2021Quote: ... and cDNA encoding human TTL (NP_714923, Origene #RC207805L2) was cloned in it for TTL expression ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human RIOK2-flag cDNAs encoding isoform I (Origene) were cloned into pRev-Tre tetracycline inducible vectors (Clontech) ...
-
bioRxiv - Neuroscience 2020Quote: The cDNA sequence of human GAPDH (OriGene, UK) was inserted into the pET-28b(+ ...
-
bioRxiv - Cancer Biology 2020Quote: ... TFE3 variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cancer Biology 2020Quote: ... human VDR transcript variant 2 cDNA (OriGene, RC519628) was transfected into the SKOV3 cells using Lipofectamine 2000TM (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... whereas the ORF encoding human p130 from Origene.
-
bioRxiv - Molecular Biology 2024Quote: ... wells containing 2 µg of human PLG (Origene) were incubated with 3 µg of D-Val-Leu-Lys 4-nitroanilide dihydrochloride chromogenic substrate (S-2251 ...
-
bioRxiv - Genomics 2021Quote: ... cells were transfected with 300 ng of each sgRNA plasmid and 40 ng of each fluorescent protein plasmid using 3.5 µL TurboFectin (OriGene). For competitor experiments ...
-
bioRxiv - Genomics 2021Quote: ... Cells were transfected with 400 ng of sgRNA-15xPBS plasmid and 40 ng of Clover-PUFc fusion plasmid DNA using 3.5 μl Turbofectin (OriGene). Media was changed at 24 hours post-transfection.
-
bioRxiv - Cell Biology 2020Quote: ... or FLAG-mNUP153 (mouse) expression vectors were constructed by amplifying full length human NUP153 or mouse NUP153 cDNA using human NUP153 cDNA (Origene, SC116943) or mouse NUP143 cDNA (ATCC ...
-
bioRxiv - Physiology 2022Quote: HeLa and SH-SY5Y CSB CRISPR-Cas9 knockouts were generated with the following plasmid: the plasmid used was modified from a pCas-Guide-EF1a-Cherry from Origene, modified to contain a guide RNA targeting the PARP binding domain of CSB ...