Labshake search
Citations for Origene Technologies :
151 - 200 of 314 citations for Human Bcl2 Associated Death Promoter BAD ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: The c-Myc tagged human Gab1 cDNA clone (RC209622) was purchased from Origene, USA ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: Full-length human dystroglycan cDNA in CMV-6 plasmid was obtained from Origene and used as a template for all of the cloning ...
-
bioRxiv - Microbiology 2023Quote: ... berghei (Pb-M1; Pb-M17) and three human M1 homologues: LTA4H (OriGene TP307617), ERAP1 (OriGene TP314469 ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with a vector expressing GFP-tagged human FXR (NM_001206979, OriGene) by using X-tremeGENE HP DNA Transfection Reagent (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary monoclonal antibodies included mouse anti-human ACE2 (1:1500) (Origene, Rockland, Maryland), rabbit anti-human (1:1000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... full length human RTEL1 was cloned into pLenti-C-myc-DDK-IRES-Puro (Origene) plasmid by digestion with AscI and MIuI and mutagenesis for RTEL1K48R was performed using QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent) ...
-
bioRxiv - Genomics 2020Quote: Human full-length INTS6 ORF in pCMV6-entry vector was purchased from Origene (RC208036). The INTS6 ORF was PCR amplified with 5’ Xho I and 3’ EcoRI restriction site overhangs and the coding sequence for a C-terminal V5 epitope tag was added in frame to the 3’ end of the INTS6 ORF (Key Resources Table ...
-
bioRxiv - Microbiology 2021Quote: Full length human ACE-2-MycDDK in pCMV-6 entry vector (Origene, cat #RC208442) was expressed in Expi293™ cells ...
-
bioRxiv - Cancer Biology 2021Quote: shRNAs constructs targeting human or mouse ATRX were obtained from OriGene (Rockville, MD, USA). The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A, OriGene, Rockville, MD, USA) and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmid DNA with complementary DNA sequences for human mtDNA was obtained from ORIGENE (SC101172). Concentrations were converted to copy number using the formula ...
-
bioRxiv - Immunology 2022Quote: ... Human MR1 transcript variant 1 (NM_001531) cDNA clone was purchased from Origene (Rockville, MD). The constructs were then cloned into a lentiviral expression vector with a multiple cloning site separated from GFP reporter via an Internal Ribosomal Entry Site (IRES ...
-
bioRxiv - Cell Biology 2020Quote: ... and human pCMV6-KLHL41-Myc-DDK (RC200295) were purchased from Origene (Rockville, MD, USA). The control (D-01910-10-50) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cryopreserved normal human kidney and tonsil tissue blocks were purchased from Origene (Rockville, MD).
-
bioRxiv - Molecular Biology 2023Quote: ... Human C-terminally Myc-FLAG-tagged ZDHHC20 (C-FLAG-D20) was purchased from Origene Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... The wild-type human genes mS25 and bS16m were obtained in plasmids from OriGene. Mutations of cysteine/s in bS16m and mS25 coordinating Fe-S clusters to alanine ...
-
bioRxiv - Cell Biology 2023Quote: ... The following substrates were used in reactions: 0.15 µg of recombinant human Treacle (OriGene), and ~25 nM Pol I or Pol II isolated from S ...
-
bioRxiv - Cell Biology 2022Quote: ... The human Hsp47 cDNA in pCMV6-XL5 plasmid was obtained from Origene (catalog#: SC119367). Scrambled siRNA GFP lentivector (catalog # ...
-
bioRxiv - Cell Biology 2023Quote: ... which were stably transfected with the human PML-VI gene (RC220236, OriGene, Rockville, MD), were selected using neomycin and were designated as HEKPML cells [34] ...
-
bioRxiv - Cancer Biology 2024Quote: USP39 Myc-DDK plasmid (NM_006590) Human Tagged ORF Clone (RC209551) was purchased from OriGene. HA-ubiquitin plasmid (#18712 ...
-
bioRxiv - Neuroscience 2024Quote: ... pericytes were transfected with the following human siRNAs (all from OriGene, Rockville, MD, USA): 3 unique 27-mer occludin-siRNAs (SR303274) ...
-
bioRxiv - Cancer Biology 2024Quote: ... oeELF3: Human hELF3 (NM_004433) in pLenti-C-Myc-DDK-P2A-Puro was purchased (OriGene Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... Recombinant human Lsm12-expression plasmids were obtained either commercially (pCMV-Lsm12-Myc-FLAG from OriGene) or were constructed with pcDNA6 (pCDNA6-Lsm12-FLAG-His) ...
-
bioRxiv - Cell Biology 2020Quote: ... THP1-derived macrophages were transfected with 10 nM siRNA targeting human TRPM7 (SR310261, OriGene, USA) following the manufacturer’s instructions using siTran1.0 (OriGene ...
-
bioRxiv - Molecular Biology 2020Quote: A human cDNA panel covering 48 major tissues was obtained from Insight Biotechnology (Origene HMRT104). Two RIF1 splicing variants were amplified by competitive PCR using a single primer pair (LW030 and LW031) ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP-tagged human sclerostin (#RG217648)- and myc-tagged mouse sclerostin (#MR222588) were purchased from Origene. KillerRed plasmid (FP966 ...
-
bioRxiv - Neuroscience 2023Quote: ... Full-length cDNA for Human KCNT1 Transcript 1 NM_020822.1 (Origene Technologies Inc, Rockville, MD, USA) was mutagenised to induce point mutations ...
-
bioRxiv - Biochemistry 2023Quote: Human cell derived recombinant eIF2A-FLAG was expressed in HEK293T cells obtained commercially (OriGene # TP304303) and buffer exchanged into Protein Storage Buffer (25 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2024Quote: ... and incubated with 5 μg/ml anti-human FcγRIIa (Origene, clone OTI9G5; 5 μg/ml) in blocking solution at 4°C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... the full length of FOXM1B was amplified from FOXM1 (NM_202003) Human cDNA Clone (#SC128214, Origene) then fused with the pBMN DHFR(DD)-mVenus ...
-
bioRxiv - Cell Biology 2021Quote: The vector expressing myc-DDK-tagged-human wt DDX6 was purchased from OriGene (RC209431, Rockville, MD). The helicase-deficient DDX6 E247A mutant was constructed by overlapping PCR using primers oVM506 5’-ACTTATCTGCCGCATCCAATACTATCATCTGGACATGAT-3’ and oVM507 5’-TTGGATGCGGCAGATAAGTTGCTGTCACAGGATTTTGTG-3’ ...
-
bioRxiv - Physiology 2020Quote: ... Human Flag- and myc-tagged GPT and GPT2 cDNA was obtained from Origene (RC203756 and RC209119). Mutagenesis of Ser126 to Arg in GPT and Ser153 to ARg in GPT2 was performed with the Q5 site-directed mutagenesis kit frm NEB (#E0554).
-
bioRxiv - Biophysics 2020Quote: ... The plasmid containing human Sirt3102-399 (pEX-His-hSIRT3102-399) was purchased from OriGene (Rockville, MD).
-
bioRxiv - Biophysics 2021Quote: ... DNA encoding ctSTIM1 (aa 233-685) was amplified by PCR from full-length human STIM1 (Origene), appending an N-terminal NcoI cleavage site ...
-
bioRxiv - Cell Biology 2021Quote: Cells were transiently transfected with a human KLK10-encoding plasmid (pCMV6-KLK10-Myc-DDK; Origene RC201139) at 0.1-1 μg/mL or as a control a GFP plasmid (PmaxGFP ...
-
bioRxiv - Cell Biology 2021Quote: ... Purified human AXIN1-MYC/DDK (TP308349) and TPX2-MYC/DDK (TP305821) proteins were obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Genetics 2020Quote: ... slices were incubated with mouse antibody against human TP53 (1:150) (ZSGB-BIO ORIGENE, Beijing, China) at 4°C followed by secondary antibody (Dako Cytomation ...
-
bioRxiv - Physiology 2020Quote: ... Human Flag- and myc-tagged GPT and GPT2 cDNA was obtained from Origene (RC203756 and RC209119). Mutagenesis of Ser125 to Arg in GPT and Ser153 to Arg in GPT2 17 was performed with the Q5 site-directed mutagenesis kit from NEB (#E0554) ...
-
bioRxiv - Cancer Biology 2021Quote: ... shSlit2 CT-2A cells were infected with SLIT2 (NM_004787) Human Tagged ORF Clone Lentiviral Particle (Origene) in accordance with manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: Genes encoding NL-Gal3 (IDT, Coralville, IA, USA) and recombinant human Gal3 (OriGene, Rockville, MD, USA) were inserted into pET-21d(+ ...
-
bioRxiv - Developmental Biology 2024Quote: ... The human full-length Mtss1 expression construct was purchased from Origene (pCMV6-hMtss1, Cat# RC218273, USA), and Myc-tagged Mtss1 deletion constructs (Mtss11I-BAR [amino acids deleted ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HEK293-Null2 cells were also co-transfected with a human MD-2 expression clone (OriGene, RC204686). JetPRIME (Polyplus ...
-
bioRxiv - Cell Biology 2023Quote: ... Human siRNA Oligo Duplex for N-Cadherin (SR300716) and α-Catenin (SR301060) were purchased from Origene. siRNA was transiently transfected to the cells through Lipofectamine RNAimax (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were transfected with either pEGFP-ARα1b or Myc-DDK-tagged human ARα1b (Origene, Rockville, MD) using Lipofectamine 3000.
-
bioRxiv - Cell Biology 2024Quote: Full-length, human, wild-type GALC cDNA (SC120078, NM_000153) was originally purchased from Origene (Rockville, MD). The cDNA was subcloned into the pBApo-CMV pur expression vector at the XbaI and PstI sites (Takara Bio ...
-
bioRxiv - Cancer Biology 2022Quote: Western blot antibodies for GOT2 detection were rabbit anti-human GOT-2 polyclonal antibody (Origene, catalog #TA325088) and HRP-conjugated AffiniPure Goat anti-rabbit IgG (ThermoFisher ...
-
bioRxiv - Biochemistry 2020Quote: ... The human doublecortin (DCX) and doublecortin-like kinases (DCLK1, DCLK2, and DCLK3) cDNAs were obtained from Origene in pCMV6 vector that also incorporates C-terminal Myc and FLAG tags (Myc-FLAG ...
-
bioRxiv - Cancer Biology 2021Quote: ... THEM6 human tagged ORF clone overexpressing plasmid and respective control (RC201709 and PS100001, Origene, Rockville, MD, USA) were purchased from Origene ...
-
bioRxiv - Microbiology 2020Quote: ... human MSR1 (Cat# RC209609) and Beclin 1 (Cat# MR207162) were obtained from Origene (Rockville, MD 20850, USA). pcDNA-FLAG-Ulk1 (Plasmid # 27636 ...
-
bioRxiv - Cancer Biology 2020Quote: ... LNCaP cells were transfected with SLFN5 (NM_144975) Human MYC-Tagged ORF Clone (RC216330, Origene, Rockville, MD, USA) or the corresponding empty vector plasmid (PS100001 ...