Labshake search
Citations for Origene Technologies :
151 - 200 of 325 citations for 1 6 ANHYDRO β D GLUCOSE 2 3 4 TRI O ACETATE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... clone 4D6 (Origene, 1:1000), anti-beta-Amyloid ...
-
bioRxiv - Genomics 2023Quote: ... MSX1 (Origene, TA590129, 1:5000), PRRX1 (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-PPP3CB (Origene, 1:200); anti-GRASP65 (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... tRFP (OriGene, TA150061, 1:250), GRIA1 (Alomone ...
-
bioRxiv - Neuroscience 2024Quote: ... SETD7(1:500, TA503322, Origene), and GAPDH (1:2,000 ...
-
bioRxiv - Cell Biology 2024Quote: ... syntenin (OriGene, TA504796, 1:1000), annexin A1 (Abcam ...
-
bioRxiv - Cancer Biology 2024Quote: ... GAPDH (OTI2D9; 1:5,000; Origene), and Actin (JLA20 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: HEK-null2 cells were transfected with a human TLR4 expression clone (pcDNA3-TLR4-YFP was a gift from Doug Golenbock – http://n2t.net/addgene:13018) and human MD-2 expression clone (Origene; RC204686) to assess cytokine secretion in response to TLR4 agonist treatments ...
-
bioRxiv - Genetics 2022Quote: ... DAB staining was performed using Polink-2 Plus HRP Polymer and AP Polymer detection for Rb antibody kit (D39-18, Origene) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... ATAGAGCGTGCGGATAATGACAAGGAGTA), Synaptojanin 2 shRNA in pRFP-C-RS vector (cat. no. FI732825, TGTGCCTCTGCGGCAGCACCAGGTGAACT and FI732826, TTGTGGAGACAGAGCAGGCGATTTACATG) were purchased from Origene. Constructs of the following proteins were kind gifts ...
-
bioRxiv - Neuroscience 2021Quote: ... Paralemmin (1:1,000, Acris-OriGene TA335984), Plasticity related protein-1 (1:1,000 (WB) ...
-
bioRxiv - Cancer Biology 2020Quote: ... NY-ESO-1 recombinant protein (Origene) at 0.5 ug/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... Hexokinase II (TA325030, 1:500, Origene), Glut1 (ab115730 ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-tGFP (1:1000 Origene, TA150041) GAPDH (1:2000 Millipore ...
-
bioRxiv - Physiology 2022Quote: ... anti-tGFP (TA150075, 1:500; Origene), anti-CoxIV (ab33985 ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-K14 (1:300, Origene #BP5009) and anti-GFP (6 μg/ml ...
-
bioRxiv - Cancer Biology 2019Quote: ... anti-HK2 (TA325030, 1:500, Origene), anti-LDHA (3582T ...
-
bioRxiv - Developmental Biology 2019Quote: ... anti-NOTCH1 (Origene, EP1238Y, 1:200), anti-Foxn1 (Santa Cruz ...
-
bioRxiv - Bioengineering 2019Quote: ... CCR7 (1:100; OriGene, cat. # TA320232), MerTk (1:200 ...
-
bioRxiv - Genetics 2021Quote: ... chicken anti-GFAP (1:200, Origene). Secondary antibodies ...
-
bioRxiv - Neuroscience 2022Quote: ... anti ABHD17 (1:1000, Origene TA331704), anti ABHD17 (1:1000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse-α-RFP (1:100, Origene), rat-α-Bcl11b (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:1000 (Origene, cat. # AB0006-200), anti-ubiquitin ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-Nav1.7 (1:500, Origene, TA329033), anti-CCT5 (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-CCT5 (1:1000, Origene, TA308298), and anti-TMED10 (1:1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... Lamp3 (1:500, #DDX0192A647-100, Origene), Npnt (1:50 ...
-
bioRxiv - Immunology 2024Quote: ... with recombinant TSP-1 (Origene, USA) at a concentration of 100ng/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... TdTomato (1:500, Origene, ABOO40-500), cMYC (1:500 ...
-
bioRxiv - Neuroscience 2020Quote: CaMKIIα and calmodulin expression in Drosophila cells was accomplished as follows: CaMKIIα and calmodulin coding sequences were copied from human cDNA clones CAMK2A transcript variant 2 (catalog SC109000, Origene, Rockville MD) and CALM1 Human calmodulin 1 transcript variant 1 (catalog SC115829 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Nrf2 was knocked-down by RNA interference (RNAi) using the following 19-bp (including a 2-deoxynucleotide overhang) siRNAs (Origene, Beijing, China): Nrf2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... staining was performed using Polink-2 Plus HRP Polymer and AP Polymer detection for Rb antibody kit (D39-18, Origene, Washington, USA) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... anti-Prx3 (Origene, TA322470, dilution 1:100) and anti-CERT (Abcam ...
-
bioRxiv - Cancer Biology 2020Quote: ... SLC7A11-shRNA sequence 1 (Origene, Cat. TL309282). Transduced cells were maintained in puromycin and GFP positive cells sorted on a BD FACS Melody cell sorter ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-mCherry (1:500, OriGene AB0081-500); anti-mKate2 for Brainbow 3.0 (gift of Dr ...
-
bioRxiv - Genomics 2021Quote: ... mouse anti-TurboGFP (1:250, Origene, TA150041) / rabbit anti-Flag (1:500 ...
-
bioRxiv - Developmental Biology 2021Quote: ... *Mouse anti-DsRd (1:500, TA180084, Origene), *Rabbit anti-DsRd (1:500 ...
-
bioRxiv - Cell Biology 2022Quote: ... SLC30A2/ZNT2 (variant 1, purchased from Origene Technologies ...
-
bioRxiv - Neuroscience 2022Quote: ... α-Gephyrin (1:1000)(OriGene Cat# TA502313, RRID:AB_11126039), and α-MAP2 (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-Flag (Origene, TA50011, 1:1,000), goat anti-Flag (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-Klf5 antibody (1:100, TA811868, Origene), anti-Bmp7 antibody (1:100 ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-Flag (Origene, TA50011, 1:1,000), goat anti-ChAT (Chemicon ...
-
bioRxiv - Developmental Biology 2022Quote: ... and anti-KRT8 (Origene, BP5075; 1:300). For secondary antibody incubation ...
-
bioRxiv - Cancer Biology 2023Quote: ... GFP (rabbit polyclonal, 1:5000, OriGene TA150122). Membranes were washed ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-CCT1 (1:200 dilution, Origene), mouse anti-CCT5 (1:200 dilution ...
-
bioRxiv - Neuroscience 2023Quote: ... and anti-TMED10 (1:1000, Origene, TA306375), overnight at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Anti-CSNK1G1 (IF: 1:50, OriGene, TA806333S); Anti-ROBO2 (IF ...
-
bioRxiv - Developmental Biology 2023Quote: ... and VSNL1 (1:100, Cat. # UM870034, OriGene). Stained organoids were imaged on an EVOS M5000 (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2023Quote: ... *Mouse anti-DsRd (1:500, TA180084, Origene), *Rabbit anti-DsRd (1:500 ...
-
bioRxiv - Genetics 2024Quote: ... anti-DNA-PK (1:4000, Origene #TA314389), anti-Rabbit-IgG (1:2000 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the membrane was incubated overnight at 4°C with primary antibody solution (1:1000 dilution for anti-TSG101 [Abcam, ab30871], anti-Calnexin [ThermoFisher, PA5-19169] and anti-Syntenin-1 [Origene, TA504796] ...