Labshake search
Citations for Origene Technologies :
101 - 150 of 278 citations for TGFB1 Human 112a.a HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... pCMV6-XL4-PPARγ (human sequence) was purchased from Origene (Rockville, MD, USA).
-
bioRxiv - Molecular Biology 2021Quote: ... Human cDNA encoding FBOX genes were procured from Origene (Rockville, MA, USA). mVenusC1 was gifted by Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... we used NSMase2 (SMPD3) Human shRNA Plasmid Kit (Origene, Locus ID 55512), which included what we termed shSMPD3 variants A-D and shScr ...
-
bioRxiv - Biochemistry 2020Quote: The human cDNA clones of LRPPRC and SLIRP were provided by OriGene (product numbers ...
-
bioRxiv - Molecular Biology 2022Quote: ... GTPBP3 (NM_001128855) Human Tagged ORF Clone was purchased from Origene (cat # RC225798).
-
bioRxiv - Cell Biology 2022Quote: ... recombinant human HMGB2 (C-terminal His tag, TP720732) from ORIGENE (Rockville, MD); anti-rabbit alkaline phosphatase-linked antibody ...
-
bioRxiv - Cell Biology 2021Quote: ... prosaposin was amplified from human prosaposin cDNA (pCMV6-XL5-PSAP, Origene, # SC118405), SBP-mCherry and the Str-KDEL_SBP-mCherry-GPI (Addgene # 65295 ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant human glutaredoxin (Grx) transcript variant 1 was from Origene (cat# TP319385) (Rockville ...
-
bioRxiv - Biophysics 2022Quote: Human LRRC8A and LRRC8C cDNAs cloned into pCMV6 were purchased from OriGene Technologies ...
-
Mitochondrial ROS1 increases mitochondrial fission and respiration in oral squamous cancer carcinomabioRxiv - Cancer Biology 2020Quote: The plasmid encoding human ROS1 (ROS1-myc, #RC220652) was obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Cancer Biology 2020Quote: ... Transfected plasmids were human MNT (pCMVSport6-MNT, Origene Technologies, Rockville, MD, USA); ΔbHLH MNT-HA (murine MNT carrying a deletion of amino acids 221-272 amino acids and tagged with HA ...
-
bioRxiv - Immunology 2022Quote: ... Human MR1 transcript variant 1 (NM_001531) cDNA clone was purchased from Origene. The constructs were then cloned into a lentiviral expression vector with a multiple cloning site separated from GFP reporter via an Internal Ribosomal Entry Site (IRES).
-
bioRxiv - Molecular Biology 2022Quote: 2.5ug Nudt6 Human Tagged ORF Clone (OriGene Technologies, Inc. Rockville, MD, USA) or GFP plasmid respectively were digested with XhoI for 1hr (New England Biolabs ...
-
bioRxiv - Neuroscience 2023Quote: We used a pCMV-human TFEB expressing vector from Origene (clone # sc122773), used previously 27 ...
-
bioRxiv - Neuroscience 2023Quote: The following plasmids have been used in the manuscript: human SATB1 (Origene), human GBA (Origene) ...
-
bioRxiv - Physiology 2023Quote: ... For human leptin ORF clone (Origene; pCMV-leptin-DDK-Myc; CAT#: RC209259) was used for mutagenizing the AIM sequences ...
-
bioRxiv - Cancer Biology 2023Quote: ... Myc-DDK tagged human CD2-associated protein (RC210191) was purchased from Origene Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... two different anti-human DSG2 antibodies (DSG2-Origene, #BM5016; DSG2-Abcam, #ab14415) were used at 1:1000 dilutions in blocking buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... A plasmid containing human APOE3-TurboGFP was purchased from Origene (Cat# RG200395). The APOE3 ORF was amplified from APOE3-TurboGFP and subcloned into an mEmerald-N1 backbone via Gibson assembly using HiFi DNA Assembly Master mix (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Constructs including human (NM_005987) and mouse Sprr1a (NM_009264) were purchased from Origene, bearing the pCMV6 vector backbone with C-terminal Myc-DDK Tag ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transfected with Twist (TWIST1) (NM_000474) Human Tagged ORF Clone (Origene). Transfected cells underwent 3 weeks selection procedure with Neomycin (400 µg/ml) ...
-
bioRxiv - Immunology 2021Quote: ... we used RUNX3 or RUNX2 human shRNA plasmid containing GFP reporter gene (Origene, Cat# ...
-
bioRxiv - Cancer Biology 2020Quote: ... We cloned SMPD3 (SMPD3 Human Tagged ORF Clone, Origene Cat#: RG218441, RefSeq-NM_018667.2) and ...
-
bioRxiv - Physiology 2020Quote: ... injected with the same dose of recombinant human NTF3 (OriGene Technologies, Rockville, MD) every day for the first two weeks ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant human YBX1 with a C-terminal FLAG-tag was purchased from OriGene Technologies ...
-
bioRxiv - Biophysics 2021Quote: ... mouse anti-human PD-L1 (primary antibody, CD273, Clone OTI9E12, ORIGENE, MD, USA) and APC goat anti-mouse IgG (secondary antibody ...
-
bioRxiv - Neuroscience 2020Quote: ... USA) and human GABAB1 and GABAB2 subunits (OriGene Technologies, Inc, Rockville, MD USA) using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... and CALM1 Human calmodulin 1 transcript variant 1 (catalog SC115829, Origene, Rockville MD), using PCR primers to add flanking restriction sites ...
-
bioRxiv - Cancer Biology 2022Quote: KDM6A targeting human shRNA expressing plasmids were purchased from OriGene (TL300596C and TL300596D). KDM6B targeting human shRNA plasmid was purchased from Sigma (TRCN0000236677) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The human SLC22A24 GFP fusion construct was purchased from OriGene (Catalog number: RG227944). The primers used to clone the GFP fusion constructs for the other non-human species are shown in S9 Table ...
-
bioRxiv - Cancer Biology 2019Quote: Human gp78/AMFR expression vector was cloned using AMFR (NM_001144) sequence (RG209639, Origene) into pDest-653 destination vector by the Protein Expression Laboratory ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and stained with 1:2000 HRP-conjugated anti-human ACE2 (clone OTI1D2, Origene) or 1:5000 HRP-conjugated donkey anti-human IgG (Jackson Immuno Research ...
-
bioRxiv - Immunology 2020Quote: Human STING and SURF4 were subcloned from HEK293T cDNA into pCMV6-AC (Origene) with a FLAG tag at the C-terminus or a HA tag at the N-terminus ...
-
bioRxiv - Immunology 2020Quote: ... and turboGFP (tGFP)-tagged human CAPRI and control tGFP alone were from OriGene Inc ...
-
bioRxiv - Immunology 2020Quote: ... The human MSR1 (Cat# RC209609) were obtained from Origene (Rockville, MD 20850, USA). Human MSR1 and its fragment 1-50 ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with a vector expressing GFP-tagged human FXR (NM_001206979, OriGene) by using X-tremeGENE HP DNA Transfection Reagent (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary monoclonal antibodies included mouse anti-human ACE2 (1:1500) (Origene, Rockland, Maryland), rabbit anti-human (1:1000 ...
-
bioRxiv - Microbiology 2023Quote: ... berghei (Pb-M1; Pb-M17) and three human M1 homologues: LTA4H (OriGene TP307617), ERAP1 (OriGene TP314469 ...
-
bioRxiv - Molecular Biology 2023Quote: The c-Myc tagged human Gab1 cDNA clone (RC209622) was purchased from Origene, USA ...
-
bioRxiv - Biochemistry 2023Quote: ... or 10 μg human ACSS2-overexpressing HEK-293 cell lysate (ref. LY412981, Origene, MD ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmid encoding human DGKε (hDGKε, NM_003647) was purchased from OriGene (cat. No. RC219913). The DGKE coding sequence was subcloned into the pcDNA3.1/Hygro(+)-2xMyc vector using primers ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: Full-length human dystroglycan cDNA in CMV-6 plasmid was obtained from Origene and used as a template for all of the cloning ...
-
bioRxiv - Molecular Biology 2020Quote: ... full length human RTEL1 was cloned into pLenti-C-myc-DDK-IRES-Puro (Origene) plasmid by digestion with AscI and MIuI and mutagenesis for RTEL1K48R was performed using QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent) ...
-
bioRxiv - Neuroscience 2019Quote: ... DNA sequences containing mouse C4B (NM_009780.2, synthesized by Genescript) and human C4A (RC235329, Origene) were subcloned (InFusion Kit ...
-
bioRxiv - Genomics 2020Quote: Human full-length INTS6 ORF in pCMV6-entry vector was purchased from Origene (RC208036). The INTS6 ORF was PCR amplified with 5’ Xho I and 3’ EcoRI restriction site overhangs and the coding sequence for a C-terminal V5 epitope tag was added in frame to the 3’ end of the INTS6 ORF (Key Resources Table ...
-
bioRxiv - Neuroscience 2019Quote: ... and human STAS (NM_015012) were generated by PCR using plasmid templates obtained from OriGene and cloned downstream of the CMV enhancer and chicken beta-actin (CB ...
-
bioRxiv - Microbiology 2021Quote: Full length human ACE-2-MycDDK in pCMV-6 entry vector (Origene, cat #RC208442) was expressed in Expi293™ cells ...
-
bioRxiv - Cancer Biology 2021Quote: shRNAs constructs targeting human or mouse ATRX were obtained from OriGene (Rockville, MD, USA). The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A, OriGene, Rockville, MD, USA) and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmid DNA with complementary DNA sequences for human mtDNA was obtained from ORIGENE (SC101172). Concentrations were converted to copy number using the formula ...