Labshake search
Citations for Origene Technologies :
101 - 150 of 241 citations for Mouse Hepatocellular carcinoma associated protein TD26 homolog ANGPTL8 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... was purchased from Sigma Aldrich and mouse anti-PDLIM2 Ab (1:250) was purchased from Origene. Rabbit anti-FAK Abs (1:500) ...
-
bioRxiv - Neuroscience 2019Quote: ... The mouse Scyl1 cDNA was amplified from a construct (MR210762, Origene) and cloned into an existing vector downstream of the T3 promoter ...
-
bioRxiv - Neuroscience 2022Quote: Short interference mouse PCBP1 RNAi plasmids were purchased from Origene (TL502540). Lentiviral particles expressing the PCBP1 shRNAi or scramble control were produced by the VirusTech Core Facility ...
-
bioRxiv - Immunology 2022Quote: ... The membrane was probed with anti-ZFP36 mouse monoclonal (Origene #OTI3D10) (2 μg/ml ...
-
bioRxiv - Biochemistry 2022Quote: The mouse Phf8 transcript (NM_177201) was purchased from Origene (Cat#: MR223276) and subcloned into a pENTR/D-TOPO vector (Thermo Fisher Scientific) ...
-
bioRxiv - Physiology 2022Quote: ... The mouse RUNX2-Myc/DDK plasmid was purchased from OriGene (MR227321), then subcloned into pLV-EF1a-IRES-Hygro (Addgene #85134) ...
-
bioRxiv - Neuroscience 2022Quote: ... Mouse P2X5 (mP2X5) cDNA in pCMV6-Entry was purchased from OriGene and subcloned into pcDNA3.1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The mouse Runx2 plasmid pCMV-Flag-mRunx2 was purchased from Origene. The fragments shown in Fig ...
-
bioRxiv - Neuroscience 2024Quote: ... with mouse monoclonal anti-FLAG antibody (anti-DDK; 1:1,000, OriGene) in blocking solution for 2–3 days ...
-
bioRxiv - Biochemistry 2024Quote: ... CDK2 mouse monoclonal antibody (HRP conjugated) [Clone ID: OTI2D9] (Origene, TA502935BM), monoclonal Anti-FLAG M2-peroxidase (HRP ...
-
bioRxiv - Immunology 2020Quote: ... HEK293T cells were individually transfected with plasmids encoding for secreted proteins (OriGene Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... ETV7 protein (Cat # TP307742) and RUVBL2 (Cat # TP300933) were purchased from Origene.
-
bioRxiv - Immunology 2021Quote: The mouse CD8a and CD8b plasmids were purchased from Origene (Rockville, MD). Catalog numbers MR227539 and MR225204 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mouse monoclonal anti-ZsGreen1 (ZSG) clone TI2C2 (1:2000) (OriGene, Cat#: TA180002); Mouse anti-capsid (1:3000 ...
-
bioRxiv - Cell Biology 2020Quote: Mouse Add1 cDNA transcript variant 1 was purchased from Origene (Cat# MR210357). The Add1 gene was amplified and subcloned into pUC19 for point mutations by the GeneArt Site-Directed Mutagenesis Plus Kit (Life Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... A Myc-Flag-tagged mouse Activin expression plasmid was purchased from Origene Technologies (MR225191) ...
-
Paracrine signalling between intestinal epithelial and tumour cells induces a regenerative programmebioRxiv - Cancer Biology 2021Quote: ... LentiThbs1Tg is a lentiORF expressing mouse Thbs1 (NM_011580) –myc-DKK (Origene #MR211744L3V). pMD2.G was a gift from Didier Trono (Addgene plasmid # 12259 ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse PRA1 cDNA was obtained from Origene (Rockville, MD, USA; Cat# MC200290). The PRA1-GFP construct was made by amplification and cloning of the PRA1 ORF into the pCAGIG vector using the XhoI/MscI restriction sites ...
-
bioRxiv - Cell Biology 2021Quote: ... The mouse AP-3μ1 expression plasmid was purchased from Origene (Ref. MR206629) and consists of AP-3μ1-myc-DDK in pCMV6-ENTRY ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse monoclonal antibody against IL-1β (Origene Inc., Cat# TA506443, 1:1000), rabbit polyclonal antibody against p65 (Abcam ...
-
bioRxiv - Molecular Biology 2023Quote: ... and mouse TMEM87A -transcript variant 1 (NM_173734; MC201598) were purchased from Origene. The coding sequences of these genes were PCR amplified and then subcloned into CMV-pIRES2-DsRed/iRFP vector using the SalI/BamHI restriction enzyme sites or CMV-EGFP-N1 vector using the EcoRI/AgeI restriction enzyme sites using the cloning kit (EZ-Fusion™ HT Cloning core Kit ...
-
bioRxiv - Immunology 2023Quote: ... and mouse anti-GAPDH monoclonal IgG (Origene TA802519, clone OTI2D9, 1:2000). Secondary antibodies were donkey anti-rabbit IgG (Alexa Fluor 790 ...
-
bioRxiv - Neuroscience 2024Quote: The pGFP-A-shAAV shRNA cloning plasmids against mouse Gprc6a (Origene, HC141118) were designed for transfection in mouse N2a cells and production for rAAVs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Constructs including human (NM_005987) and mouse Sprr1a (NM_009264) were purchased from Origene, bearing the pCMV6 vector backbone with C-terminal Myc-DDK Tag ...
-
bioRxiv - Neuroscience 2023Quote: ... Silent mutations disrupted the internal EcoRI sites of mouse KitL (MC204279, OriGene), the KitL coding sequence was then flanked by EcoRI sites ...
-
bioRxiv - Biochemistry 2020Quote: Recombinant Myc-Flag-RNF114 proteins were purchased from Origene (Origene Technologies Inc., TP309752) or were purified as described previously(Spradlin et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... Galectin-3-binding protein ORF was subcloned from its source vector (Origene # RC204918) into bicistronic lentiviral transfer vector pHR-CMV-TetO2 3C-TwinStrep-IRES-EmGFP vector (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... or α-CD68 (1:2000, mouse monoclonal, clone BM4000, OriGene Technologies, Rockville, USA). An α-mouse ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... HEI-OC1 cells were transfected with a mouse Tlr4 expression clone (Origene; MR210887) to test for complementation of the Tlr4 deletion strain ...
-
bioRxiv - Biophysics 2021Quote: ... mouse anti-human PD-L1 (primary antibody, CD273, Clone OTI9E12, ORIGENE, MD, USA) and APC goat anti-mouse IgG (secondary antibody ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... mouse anti-ZEB2 (Origene, TA802113, IF 1:150, WB 1:2000 in milk), sheep anti-TBR2 (R&D Systems ...
-
bioRxiv - Cell Biology 2023Quote: ... GFP-tagged mouse Suv39h1 (NM_011514) was purchased from Origene (#MG206488; Rockville, MD, USA). pEGFP-C1-human SUV39H1 was previously described [7] ...
-
bioRxiv - Cancer Biology 2023Quote: ... and anti-LGR5 mouse monoclonal conjugated with PE at 1:100 (Origene #TA400001). Apart from the LGR5 antibody incubation (of 20 minutes) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary monoclonal antibodies included mouse anti-human ACE2 (1:1500) (Origene, Rockland, Maryland), rabbit anti-human (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse Pla2g2a-Myc-DDK construct was obtained from Origene (m-sPLA2-IIA-myc). Mouse PGRN construct was cloned into pSecTag2B vector (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... 100 μg of lysates or 100 ng of TDP-43 recombinant protein (NM_007375, OriGene) was incubated with 30 pmol of biotin-labelled RNA for 1 h at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 0.012 μg of bacterially produced and purified recombinant IMP3 protein (Origene, cat#TP760798) in hypotonic lysis buffer (5 mM Tris ...
-
bioRxiv - Developmental Biology 2021Quote: ... The CatSper1 ORF was amplified from a mouse cDNA clone (Cat. No. MR224271, Origene). C2cd6s was subcloned into pcDNA3.1/myc-His A vector (Cat ...
-
bioRxiv - Neuroscience 2019Quote: ... DNA sequences containing mouse C4B (NM_009780.2, synthesized by Genescript) and human C4A (RC235329, Origene) were subcloned (InFusion Kit ...
-
bioRxiv - Neuroscience 2021Quote: The pCMV6-Arc-Myc-DDK (FLAG) mouse ORF cDNA clone (MR206218) was from OriGene Biotechnologies (Rockville ...
-
bioRxiv - Cancer Biology 2021Quote: shRNAs constructs targeting human or mouse ATRX were obtained from OriGene (Rockville, MD, USA). The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA for mouse Btbd11 was purchased C-terminal Myc tag (Origene catalog number: MR217199). Using this cDNA as template pCAG-GFP-Btbd11 was generated ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse Climp-63 tagged with Myc-DDK in the C terminal (Origene Catalog: MR215622) was cloned in an Ad5 backbone from Vector BioLabs ...
-
bioRxiv - Systems Biology 2023Quote: ... cells were transfected with 100 ng Fgf1 (NM_010197) Mouse Tagged ORF Clone (ORIGENE, MR201152) or control empty vector using Lipofectamine 3000 Transfection Reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse monoclonal antibody directed against α1-actinin (#TA500072S, IF dilution 1:100) was from Origene. Phalloidin-Alexa488 ...
-
bioRxiv - Neuroscience 2020Quote: Full-length cDNAs encoding mouse IgSF8 (BC048387) and Tenascin-R (BC138043) were purchased from Origene and Source Bioscience ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B, OriGene, Rockville, MD, USA). A shRNA 29-mer scrambled shRNA was used as a negative control (TR30021V ...
-
bioRxiv - Cancer Biology 2020Quote: ... A primary mouse monoclonal Lysyl Hydroxylase 2 (LH2) antibody (Origene; Cat# TA803224, dilution 1:150) was used for the immunohistochemical staining.
-
bioRxiv - Physiology 2020Quote: The mouse clone of LRMP in pCMV6 was purchased from OriGene (Rockville, MD; Cat. #MC228229). The mouse variant of IRAG in pReceiver-M61 was purchased from GeneCopoeia (Rockville ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP-tagged human sclerostin (#RG217648)- and myc-tagged mouse sclerostin (#MR222588) were purchased from Origene. KillerRed plasmid (FP966 ...