Labshake search
Citations for Origene Technologies :
101 - 150 of 307 citations for Mouse Anti Chlamydia LPS 1681 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Paracrine signalling between intestinal epithelial and tumour cells induces a regenerative programmebioRxiv - Cancer Biology 2021Quote: ... LentiThbs1Tg is a lentiORF expressing mouse Thbs1 (NM_011580) –myc-DKK (Origene #MR211744L3V). pMD2.G was a gift from Didier Trono (Addgene plasmid # 12259 ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse PRA1 cDNA was obtained from Origene (Rockville, MD, USA; Cat# MC200290). The PRA1-GFP construct was made by amplification and cloning of the PRA1 ORF into the pCAGIG vector using the XhoI/MscI restriction sites ...
-
bioRxiv - Cell Biology 2021Quote: ... The mouse AP-3μ1 expression plasmid was purchased from Origene (Ref. MR206629) and consists of AP-3μ1-myc-DDK in pCMV6-ENTRY ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse monoclonal antibody against IL-1β (Origene Inc., Cat# TA506443, 1:1000), rabbit polyclonal antibody against p65 (Abcam ...
-
bioRxiv - Molecular Biology 2023Quote: ... and mouse TMEM87A -transcript variant 1 (NM_173734; MC201598) were purchased from Origene. The coding sequences of these genes were PCR amplified and then subcloned into CMV-pIRES2-DsRed/iRFP vector using the SalI/BamHI restriction enzyme sites or CMV-EGFP-N1 vector using the EcoRI/AgeI restriction enzyme sites using the cloning kit (EZ-Fusion™ HT Cloning core Kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... Constructs including human (NM_005987) and mouse Sprr1a (NM_009264) were purchased from Origene, bearing the pCMV6 vector backbone with C-terminal Myc-DDK Tag ...
-
bioRxiv - Neuroscience 2024Quote: The pGFP-A-shAAV shRNA cloning plasmids against mouse Gprc6a (Origene, HC141118) were designed for transfection in mouse N2a cells and production for rAAVs ...
-
bioRxiv - Neuroscience 2023Quote: ... Silent mutations disrupted the internal EcoRI sites of mouse KitL (MC204279, OriGene), the KitL coding sequence was then flanked by EcoRI sites ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the membrane was incubated overnight at 4°C with primary antibody solution (1:1000 dilution for anti-TSG101 [Abcam, ab30871], anti-Calnexin [ThermoFisher, PA5-19169] and anti-Syntenin-1 [Origene, TA504796] ...
-
bioRxiv - Cell Biology 2020Quote: ... or α-CD68 (1:2000, mouse monoclonal, clone BM4000, OriGene Technologies, Rockville, USA). An α-mouse ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... HEI-OC1 cells were transfected with a mouse Tlr4 expression clone (Origene; MR210887) to test for complementation of the Tlr4 deletion strain ...
-
bioRxiv - Cell Biology 2023Quote: ... GFP-tagged mouse Suv39h1 (NM_011514) was purchased from Origene (#MG206488; Rockville, MD, USA). pEGFP-C1-human SUV39H1 was previously described [7] ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse Pla2g2a-Myc-DDK construct was obtained from Origene (m-sPLA2-IIA-myc). Mouse PGRN construct was cloned into pSecTag2B vector (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... or anti EGFP (Origene) primary antibody ...
-
bioRxiv - Genomics 2020Quote: ... Anti-Dendra2 (OriGene TA180094), Anti-TFIIB (Cell Signaling 4169) ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-ANP32E (OriGene, TA351339), anti-H3 (Abcam ...
-
bioRxiv - Microbiology 2019Quote: ... and anti-HA (Origene) mouse monoclonal antibodies were used as primary antibodies for immunoblotting and immunoprecipitation ...
-
bioRxiv - Biochemistry 2021Quote: ... anti-Ago2 (Origene, TA352430) and anti-ATIII antibodies ...
-
bioRxiv - Immunology 2022Quote: ... anti-NEU2 (TA324482, Origene) or (24523-1-AP ...
-
bioRxiv - Immunology 2022Quote: ... anti-NEU3 (TA590228, Origene) or (27879-1-AP ...
-
bioRxiv - Neuroscience 2023Quote: ... chicken anti-GFAP (Origene, AP31806PU-N ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-KRas antibody (OriGene, mouse monoclonal #CF801672 ...
-
bioRxiv - Microbiology 2023Quote: ... anti-IFIT1 (#TA500948; OriGene), anti-IFITM-3 (#AP1153a ...
-
bioRxiv - Developmental Biology 2021Quote: ... The CatSper1 ORF was amplified from a mouse cDNA clone (Cat. No. MR224271, Origene). C2cd6s was subcloned into pcDNA3.1/myc-His A vector (Cat ...
-
bioRxiv - Neuroscience 2019Quote: ... DNA sequences containing mouse C4B (NM_009780.2, synthesized by Genescript) and human C4A (RC235329, Origene) were subcloned (InFusion Kit ...
-
bioRxiv - Neuroscience 2021Quote: The pCMV6-Arc-Myc-DDK (FLAG) mouse ORF cDNA clone (MR206218) was from OriGene Biotechnologies (Rockville ...
-
bioRxiv - Cancer Biology 2021Quote: shRNAs constructs targeting human or mouse ATRX were obtained from OriGene (Rockville, MD, USA). The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA for mouse Btbd11 was purchased C-terminal Myc tag (Origene catalog number: MR217199). Using this cDNA as template pCAG-GFP-Btbd11 was generated ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse Climp-63 tagged with Myc-DDK in the C terminal (Origene Catalog: MR215622) was cloned in an Ad5 backbone from Vector BioLabs ...
-
bioRxiv - Systems Biology 2023Quote: ... cells were transfected with 100 ng Fgf1 (NM_010197) Mouse Tagged ORF Clone (ORIGENE, MR201152) or control empty vector using Lipofectamine 3000 Transfection Reagent (Invitrogen ...
-
bioRxiv - Genomics 2024Quote: Knock-out was performed using the TDG mouse Gene Knock-Out kit (Origene, KN317363). This kit contained two gRNAs that targeted the first exon of TDG gene and a donor vector that contained a GFP-Puromycin cassette to facilitate the screening process ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-GAPDH (2D9) and a rabbitt polyclonal anti-CEACAM1 (TA350817) antibody were from Origene. Anti-Rabbit-HRP and anti-mouse-HRP were from Cell Signalling Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... and anti-ACTB (TA811000, Origene) were used for immunoblotting ...
-
bioRxiv - Cancer Biology 2020Quote: ... Anti-Bcl-xL siRNAs (Origene) was diluted in jetPRIME (Polyplus transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... rabbit anti-MMP9 (OriGene, TA326652), anti-GAPDH (Santa Cruz Biotechnology ...
-
bioRxiv - Biochemistry 2019Quote: ... Anti-La (Origene Technologies, #TA500406) was added to the post nuclear supernatant to a final concentration of 2ug/500ul and the mixture was incubated with rotation overnight at 4°C ...
-
bioRxiv - Physiology 2019Quote: ... anti-CYP2B (Origene, Catalog# TA504328) were applied to the sections at 1:100 dilution and incubated overnight at 4□°C ...
-
bioRxiv - Physiology 2023Quote: ... anti-Mitodendra2 (TA150090) from OriGene; anti-GAPDH (GTX627408 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-cytokeratin 8 (Origene BP5074), anti-Ki67-FITC (eBioscience 11-5698-90) ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-PPP3CB (Origene, 1:200); anti-GRASP65 (1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse monoclonal antibody directed against α1-actinin (#TA500072S, IF dilution 1:100) was from Origene. Phalloidin-Alexa488 ...
-
bioRxiv - Neuroscience 2020Quote: Full-length cDNAs encoding mouse IgSF8 (BC048387) and Tenascin-R (BC138043) were purchased from Origene and Source Bioscience ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B, OriGene, Rockville, MD, USA). A shRNA 29-mer scrambled shRNA was used as a negative control (TR30021V ...
-
bioRxiv - Genomics 2021Quote: The Zcchc8 KN2.0 non-homology mediated mouse gene knockout kit (KN519669) was purchased from OriGene. Either the pCas-Guide CRISPR vector (OriGene ...
-
bioRxiv - Cancer Biology 2020Quote: ... A primary mouse monoclonal Lysyl Hydroxylase 2 (LH2) antibody (Origene; Cat# TA803224, dilution 1:150) was used for the immunohistochemical staining.
-
bioRxiv - Physiology 2020Quote: The mouse clone of LRMP in pCMV6 was purchased from OriGene (Rockville, MD; Cat. #MC228229). The mouse variant of IRAG in pReceiver-M61 was purchased from GeneCopoeia (Rockville ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP-tagged human sclerostin (#RG217648)- and myc-tagged mouse sclerostin (#MR222588) were purchased from Origene. KillerRed plasmid (FP966 ...
-
bioRxiv - Neuroscience 2023Quote: ... Each virus expressed the full-length sequence for either mouse Elp1 (Origene MC202501, NM 026079) or human ELP1 (Origene RC2076868) ...
-
bioRxiv - Microbiology 2021Quote: ... and rabbit anti-Spike MAb (Origene), diluted as above ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-Bcl-xL (clone 4A9, Origene), and β-tubulin (clone TU-06 ...