Labshake search
Citations for Origene Technologies :
101 - 145 of 145 citations for Caspase 2 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... the antibodies used were rabbit monoclonal anti-GLI1 (Clone EPR4523, Origene Technologies) at a 1:1000 dilution and anti-Lamin A/C (Cell Signaling Technologies 2032 ...
-
bioRxiv - Biochemistry 2022Quote: ... and Rabbit Polyclonal Anti-METTL7A Antibody was obtained from Origene (Rockville, MD). Reagents and materials for cell culture and gene modulation ...
-
bioRxiv - Cell Biology 2020Quote: ... We used the following primary antibodies: α-PRX3 (TA322472, rabbit; Origene, Rockville, USA), α-Mitofilin (ab48139 ...
-
bioRxiv - Neuroscience 2020Quote: ... and C and Nuak kinases 1 and 2 were purchased from OriGene Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... then fixed with 4% PFA and stained with 1:5000 rabbit anti-EGFP (Origene) and anti-rabbit AF647 (10μg/ml ...
-
bioRxiv - Genomics 2021Quote: ... and polyclonal anti-rabbit IgG-HRP raised in goat (R1364HRP, 1:5,000; OriGene, Herford, Germany)
-
bioRxiv - Microbiology 2020Quote: The antibodies used in the study include: polyclonal rabbit anti-RBBP6 antibody (Origene Technologies, TA309830), polyclonal rabbit anti-hnRNPL (Abcam ...
-
bioRxiv - Genomics 2021Quote: ... the corresponding horseradish peroxidase (HRP)-conjugated Goat anti-Rabbit IgG secondary antibody (Origene, Cat#PV-6002) was sequentially used for incubation at room temperature for 30 minutes ...
-
bioRxiv - Developmental Biology 2021Quote: ... cells were transduced (MOI=2) with a lentivirus constitutively expressing GFP (OriGene Tech # PS100093V). A pure GFP population was generated with puromycin selection for a few days in culture before use in experiments and cell line storage.
-
bioRxiv - Microbiology 2021Quote: Full length human ACE-2-MycDDK in pCMV-6 entry vector (Origene, cat #RC208442) was expressed in Expi293™ cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... China) and Native ORF cIAP-2 clone in pCMV vector was purchased from Origene, Rockville ...
-
bioRxiv - Cancer Biology 2019Quote: ... KDELR3 transcript variant 2 (NM_016657) Human Myc-DDK-tagged ORF Clone (Origene, CAT#: RC216726), KDELR3 transcript variant 1 (NM_006855 ...
-
bioRxiv - Developmental Biology 2022Quote: ... the slides were incubated with goat anti-rabbit IgG conjugated to horseradish peroxidase (HRP) (ORIGENE, ZB-2301) at RT for 1 h ...
-
bioRxiv - Neuroscience 2022Quote: ... were double immunostained using the following antisera couples: a) rabbit polyclonal anti-GLP-1R (1:50; Origene) and mouse monoclonal anti-NUCB2/nesfatin-1 antibody (1:50 ...
-
bioRxiv - Cancer Biology 2020Quote: ... A primary mouse monoclonal Lysyl Hydroxylase 2 (LH2) antibody (Origene; Cat# TA803224, dilution 1:150) was used for the immunohistochemical staining.
-
bioRxiv - Immunology 2022Quote: Lung section slides were also stained with 1 µg/mL rabbit polyclonal anti-NEU1 (TA335236; Origene, Rockville, MD), anti-NEU2 (TA324482 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HEK293-Null2 cells were also co-transfected with a human MD-2 expression clone (OriGene, RC204686). JetPRIME (Polyplus ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were incubated with a mixture of primary rabbit anti–GFP antibody (1:500; catalog #SP3005P, OriGene, Rockville, MD) and mouse anti–NeuN antibody (1:1000 ...
-
The transcriptomic landscape of monosomy X (45,X) during early human fetal and placental developmentbioRxiv - Genetics 2024Quote: ... then incubation was undertaken with a primary rabbit polyclonal CSF2RA (GM-CSF receptor alpha) antibody for 1 hour (Origene TA323990S ...
-
bioRxiv - Biophysics 2022Quote: ... Msi-2 cDNA (residues 234–328, according to the alignment with Msi-1C) was purchased from OriGene. All these variants were constructed in a pET21 vector backbone with a hexa-histidine tag on the C-terminus of the expressed protein ...
-
bioRxiv - Cell Biology 2022Quote: ... ATG7-/- and Scr Caco-2 cells as discussed previously.11 Occludin ORF in pCMV6-AC-GFP (Origene) and corresponding control plasmid were used to transfect Caco-2 cells using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... 0.64 μg of pMD2G-VSVG and 0.64 μg of pspAX.2 using transfecting reagent Megatran 1.0 (Origene).
-
bioRxiv - Genetics 2023Quote: ... Sections were incubated overnight at 4 °C with an anti-Cnn1 rabbit monoclonal primary antibody (1:400 dilution; TA327614; Origene), or a CD68 rabbit polyclonal antibody (1:300 dilution ...
-
bioRxiv - Genetics 2020Quote: Thymidine Kinase 2 Human Untagged Clone (NM_004614) containing the cDNA for transcript variant 1 was purchased from OriGene Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sections were then incubated overnight at 4 °C with one of the following primary antibodies: rabbit polyclonal anti-mGFP (TA150122, OriGene, USA), mouse anti-hNuclei ...
-
bioRxiv - Cancer Biology 2023Quote: ... the slides were washed three times with PBS and incubated with secondary antibodies (hypersensitive enzyme-labeled goat anti-mouse/rabbit IgG polymer (OriGene, China) at room temperature for 20 min ...
-
bioRxiv - Microbiology 2024Quote: ... S1PR2 expression in J2 HIEs was detected by Western blot analysis using rabbit S1PR2 polyclonal antibody (1:500; #AP01198PU-N, OriGene Technologies). Villin was used as cell loading control and detected using 1:1000 dilution of mouse anti-villin (#sc-373997 ...
-
bioRxiv - Immunology 2021Quote: ... HAP1 cells were transfected with 2 µg lentiCRISPR v2 bearing the sgRNA of interest in the presence of transfection reagent Turbofectin 8.0 (OriGene). Transfected cells were selected with 2 µg/ml puromycin (InvivoGen ...
-
bioRxiv - Cell Biology 2021Quote: ... human TCEAL4 transcript variant 1) and pCMV6-TCEAL4 isoform-2 (CAT#: SC335597, NM_001300901, human TCEAL4 transcript variant 5) were both from Origene. TCEAL4 isoform-1 was cloned from pCMV6-TCEAL4-MYC-FLAG with the Gateway cloning system into pDONR223 and then into the destination vector pEGFP_GW ...
-
bioRxiv - Cancer Biology 2019Quote: ... CRISPR/Cas9 plasmid at 2 μg concentration was transfected by Turbofectin 8.0 following the protocol from OriGene (Rockville, MD).
-
bioRxiv - Immunology 2019Quote: ... 31) and myc-FLAG-tagged Syncytin-1 and 2 expression constructs in the pCMV6 vector were purchased from Origene. pFR-Luc and pBD-NFkB (Agilent ...
-
bioRxiv - Microbiology 2021Quote: ... MLV P30 protein within the pseudovirus capsid was detected using a rabbit anti-MLV-P30 polyclonal antibody (Origene, Cat. No. AP33447PU-N) and an HRP-conjugated goat anti-rabbit IgG Fc secondary antibody (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA); the goat anti-mouse MSR1 (Cat# AF1797) ...
-
bioRxiv - Immunology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA). The mouse anti-human MSR1 (Cat# MAB2708 ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated overnight at 4 °C using a rabbit polyclonal anti-GLP-1R antibody (1:50; Origene, Rockville, MD, USA, TA336864). Specificity of GLP-1R antiserum has been previously described in detail [21–23] ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: HEK-null2 cells were transfected with a human TLR4 expression clone (pcDNA3-TLR4-YFP was a gift from Doug Golenbock – http://n2t.net/addgene:13018) and human MD-2 expression clone (Origene; RC204686) to assess cytokine secretion in response to TLR4 agonist treatments ...
-
bioRxiv - Cell Biology 2021Quote: ... the small hairpin (shRNA)-expressing vectors pSUPER.neo (R4-1) (Fleig et al., 2012) and a pRS vector-based construct targeting 5’- ATGAGGAGACAGCGGCTTCACAGATTCGA-3’ (R4-2) (OriGene) were used ...
-
bioRxiv - Molecular Biology 2022Quote: ... Blots were blocked for 1 hour at room temperature with 2% BSA diluted in PBST and incubated overnight at 4 °C with 25 μg/ml of PLG (Origene) diluted in blocking solution ...
-
bioRxiv - Genetics 2022Quote: ... DAB staining was performed using Polink-2 Plus HRP Polymer and AP Polymer detection for Rb antibody kit (D39-18, Origene) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... ATAGAGCGTGCGGATAATGACAAGGAGTA), Synaptojanin 2 shRNA in pRFP-C-RS vector (cat. no. FI732825, TGTGCCTCTGCGGCAGCACCAGGTGAACT and FI732826, TTGTGGAGACAGAGCAGGCGATTTACATG) were purchased from Origene. Constructs of the following proteins were kind gifts ...
-
bioRxiv - Immunology 2022Quote: ... Cells (1 × 105) were mixed with 2 μg of 100 μg/ml of murine NEU3 expression plasmid (MR223297; Origene, Rockville, MD) in 100 μl PBS (GE Lifesciences ...
-
bioRxiv - Molecular Biology 2024Quote: Trastuzumab light chains 1 and 2 were obtained by Tebubio Srl and cloned in the CD81-GFP vector (OriGene, 7268 bp), obtaining the antiHER2 construct (CD81-antiHER2-GFP ...
-
bioRxiv - Neuroscience 2020Quote: CaMKIIα and calmodulin expression in Drosophila cells was accomplished as follows: CaMKIIα and calmodulin coding sequences were copied from human cDNA clones CAMK2A transcript variant 2 (catalog SC109000, Origene, Rockville MD) and CALM1 Human calmodulin 1 transcript variant 1 (catalog SC115829 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Nrf2 was knocked-down by RNA interference (RNAi) using the following 19-bp (including a 2-deoxynucleotide overhang) siRNAs (Origene, Beijing, China): Nrf2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... staining was performed using Polink-2 Plus HRP Polymer and AP Polymer detection for Rb antibody kit (D39-18, Origene, Washington, USA) following manufacturer’s instructions ...