Labshake search
Citations for Origene Technologies :
1251 - 1300 of 1832 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... and H-2L (#MC227254, Origene). Amplification of cDNA was conducted using T7 forward primers and cDNA-based RNA was generated using HiScribeTM T7 Quick High-Yield RNA Synthesis kit (New England Biolabs ...
-
bioRxiv - Cell Biology 2021Quote: ... H-2D (#MC208623, Origene, Rockville, MD) and H-2L (#MC227254 ...
-
bioRxiv - Cell Biology 2021Quote: ... Myc- and DDK-tagged hemopexin plasmid was purchased from Origene. Glycosylation and cysteine mutations were made with the Quick Change II Site-Directed Mutagenesis kit (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-CC10 (Origene, AM26360PU-N), Mouse-anti-CD63 (DSHB Hybridoma Product H5C6 ...
-
bioRxiv - Cell Biology 2021Quote: ... Hexokinase II (TA325030, 1:500, Origene), Glut1 (ab115730 ...
-
bioRxiv - Cell Biology 2021Quote: ... human TCEAL4 transcript variant 1) and pCMV6-TCEAL4 isoform-2 (CAT#: SC335597, NM_001300901, human TCEAL4 transcript variant 5) were both from Origene. TCEAL4 isoform-1 was cloned from pCMV6-TCEAL4-MYC-FLAG with the Gateway cloning system into pDONR223 and then into the destination vector pEGFP_GW ...
-
The heterogeneity of the DNA damage response landscape determines patient outcomes in ovarian cancerbioRxiv - Cell Biology 2021Quote: ... were transformed with reconstituted pCMV6-AC-GFP plasmid (ps100010; Origene). EcoRI-HF (R3101S) ...
-
bioRxiv - Microbiology 2021Quote: ... Membranes of blots were successively incubated with anti-Hfq polyclonal antibody from Goat (Origene, Germany), with anti-goat secondary antibody coupled to alkaline phosphatase (Sigma ...
-
bioRxiv - Immunology 2021Quote: NLRP1 and CARD8 transcript variant 1 DNA obtained commercially from Origene (pCMV6-entry clones RC216481 and RC230245 ...
-
bioRxiv - Immunology 2021Quote: ... The cDNA coding for FcγRI was amplified from the NM_000566 cDNA (Origene) with the following primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mouse monoclonal anti-ZsGreen1 (ZSG) clone TI2C2 (1:2000) (OriGene, Cat#: TA180002); Mouse anti-capsid (1:3000 ...
-
bioRxiv - Physiology 2021Quote: ... and with 300 ng of cDNA plasmid encoding wild-type or mutant human TRPA1 (pCMV6-XL4 vector, OriGene Technologies, Rockville, MD, USA). The cells were used 24–48 h after transfection ...
-
bioRxiv - Microbiology 2021Quote: ... TMPRSS2 human plasmid (Origene) was transfected using X-tremeGENE HP Transfection Reagent (Merck ...
-
bioRxiv - Microbiology 2021Quote: Full length human ACE-2-MycDDK in pCMV-6 entry vector (Origene, cat #RC208442) was expressed in Expi293™ cells ...
-
bioRxiv - Microbiology 2021Quote: ... and the corresponding empty pLenti-Flag vector were purchased from Origene. HA-tagged TASOR are expressed from the pAS1b vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B, OriGene, Rockville, MD, USA). A shRNA 29-mer scrambled shRNA was used as a negative control (TR30021V ...
-
bioRxiv - Cancer Biology 2021Quote: shRNAs constructs targeting human or mouse ATRX were obtained from OriGene (Rockville, MD, USA). The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A, OriGene, Rockville, MD, USA) and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B ...
-
bioRxiv - Cancer Biology 2021Quote: ... A shRNA 29-mer scrambled shRNA was used as a negative control (TR30021V, OriGene, Rockville, MD, USA).
-
bioRxiv - Cancer Biology 2021Quote: ... T192-RFP-3xHA - was generated by subcloning the cDNA of TMEM192 (Origene) together with monomeric Red Fluorescent Protein (mRFP ...
-
bioRxiv - Genomics 2021Quote: ... it was determined that the greatest knockout efficiency had been achieved using the pCas-Guide CRISPR vector with guide RNA sequence of 5’-TAGGTCGCCAAAATCCACAC-3’ (OriGene, KN519669G1). These cells were chosen to produce individual clones using standard single cell cloning techniques in 96-well plates.
-
bioRxiv - Genomics 2021Quote: ... 1.0 μg of linear donor cassette with EF1a promoter followed by eGFP-P2A-Puromycin resistance (OriGene, KN519669D) and 2.0 μl of P3000 reagent per μl DNA was diluted into 125 μl of serum-free Opti-MEM ...
-
bioRxiv - Genomics 2021Quote: ... Either the pCas-Guide CRISPR vector (OriGene, KN519669G1) containing a single guide RNA target sequence 5’-TAGGTCGCCAAAATCCACAC-3’ or the pCas-Guide CRISPR vector (OriGene ...
-
bioRxiv - Genomics 2021Quote: ... containing a single guide RNA target sequence 5’-TAGGTCGCCAAAATCCACAC-3’ or the pCas-Guide CRISPR vector (OriGene, KN519669G2) containing a single guide RNA target sequence 5’-CGAGGCGTTTGACCCACCAG-3’ or a combination of the two was transfected into the mouse submandibular salivary gland cell line SIMS using Thermo Fisher’s Lipofectamine 3000 Reagent kit in the following manner ...
-
bioRxiv - Genomics 2021Quote: The Zcchc8 KN2.0 non-homology mediated mouse gene knockout kit (KN519669) was purchased from OriGene. Either the pCas-Guide CRISPR vector (OriGene ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNA of human FIP200 was purchased from OriGene (SC114884), pmCherry_Gal3 was a gift from Hemmo Meyer (Addgene plasmid #85662 ...
-
bioRxiv - Cell Biology 2021Quote: ... NPC1 human fibroblasts were transfected with either eGFP-Vector (pCMV6-AC-GFP Tagged Cloning Vector, Cat #PS100010, Origene Technologies) or eGFP-HSP40 (DNAJB11 (NM_016306 ...
-
bioRxiv - Cell Biology 2021Quote: rKLK10 (500 ng, described above) was incubated with wild-type human recombinant (rHTRA1) (500 ng, Origene TP322362) or kinase-inactive rHTRA1 containing an S328A mutation (500 ng Origene TP700208 ...
-
bioRxiv - Cell Biology 2021Quote: ... or kinase-inactive rHTRA1 containing an S328A mutation (500 ng Origene TP700208) for 18hrs at 37° ...
-
bioRxiv - Cell Biology 2021Quote: ... A nontargeting 29-mer scrambled shRNA cassette in pGFP-C-shLenti vector (TR30021, OriGene) served as a control ...
-
bioRxiv - Cell Biology 2021Quote: Short hairpin RNAs (shRNAs) targeting Acsl4 (TL502838, OriGene) were packaged in the pGFP-C-shLenti plasmid system ...
-
bioRxiv - Cell Biology 2021Quote: ... Antibodies or reagents used were: (i) CD235a-PE (1:2500 dilution; OriGene cat#DM066R), CD49d-BV421 (1:100 dilution ...
-
bioRxiv - Biophysics 2021Quote: ... DNA encoding ctSTIM1 (aa 233-685) was amplified by PCR from full-length human STIM1 (Origene), appending an N-terminal NcoI cleavage site ...
-
bioRxiv - Cancer Biology 2021Quote: ... BTSCs were electroporated with pCMV6-LGALS1-Myc-DDK mammalian vector (OriGene, #RC204674).
-
bioRxiv - Cancer Biology 2021Quote: ... anti-DDK (FLAG) antibody (OriGene, #TA150014) or rabbit IgG (Cell Signaling ...
-
bioRxiv - Cancer Biology 2021Quote: ... the anti-MYC antibody 9E10 was from Origene, the anti-Strep-tag antibody from Biorad ...
-
bioRxiv - Cell Biology 2021Quote: ... the OSTM1-Myc insert from pCMV6-OSTM1-MYC-FLAG (RC209871, Origene) was amplified by PCR using forward primers (OSTM1 ...
-
bioRxiv - Cell Biology 2021Quote: The plasmid-based expression construct pcDNA4/TO-GFP-CLC7 was generated by amplifying the CLC7 insert of pCMV6-CLC7-Myc-FLAG (RC203450, Origene, Rockville, MD) using PCR with a forward primer (5’-CATCATAAGCTTGGAGCTATGG CCAACGTCTCTAAGAAGGTGTC ...
-
bioRxiv - Cell Biology 2021Quote: ... HAP1 cells were transfected using TurboFectin 8.0 (Origene) according to the manufacturer’s instructions with a plasmid encoding spCas9 and an sgRNA targeting the C-terminal sequence of KPNA2 (5’-AGGCTACACTTTCCAAGTTC-3’) ...
-
bioRxiv - Cell Biology 2021Quote: ... gRNA2 or scramble along with the donor cassette using TurboFectin (Origene, cat# TF81001). Forty-eight hours post-transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... tissue sections were stained with hematoxylin and eosin (Origene). For IHC staining ...
-
bioRxiv - Cancer Biology 2021Quote: ... We transfected RAW 264.7 macrophages with 10nM final siRNA concentration using siTran1.0 transfection reagent (Origene), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: We purchased paraffin-embedded sections of prostate specimens from 6 healthy volunteers and 11 patients with prostate cancer (OriGene Technologies). Characteristics of human patients with prostate cancer are summarized in table S3.
-
bioRxiv - Cancer Biology 2021Quote: ... Robo2 and control siRNAs were purchased from Origene. We transfected RAW 264.7 macrophages with 10nM final siRNA concentration using siTran1.0 transfection reagent (Origene) ...
-
bioRxiv - Cancer Biology 2021Quote: ... LHX1 (OriGene #TA504528; 1:1000); LTL-Biotinylated (Vectorlabs B-1325 ...
-
bioRxiv - Cell Biology 2021Quote: ... The following primary antibodies were used: anti-mCherry (AB0040-200, Origene, 1:500), anti-myc 9E10 (13-2500 ...
-
bioRxiv - Cell Biology 2021Quote: ... CLIP-RAMP2 [cloned in-house and sequence-verified from RAMP2 (Origene) and CLIP-β2-AR (a gift from Professor Davide Calebiro ...
-
bioRxiv - Cell Biology 2021Quote: ... GCGR-GFP (both Origene), RAMP2-CFP ...
-
bioRxiv - Cell Biology 2021Quote: ... Snx1-turboGFP and Ccz1-myc were from Origene (#RG201844 and RC222195). GFP-Rab7a was generated by substituting mApple in the Rab7a plasmid with GFP from GFP-Rab11a using NheI and XhoI restriction sites.
-
bioRxiv - Cell Biology 2021Quote: Constructs of individual c-myc tagged human TRAP subunits (α, β, δ) under the CMV promotor were purchased from OriGene Technologies (#RC202408 ...