Labshake search
Citations for Origene Technologies :
51 - 60 of 60 citations for hsa mir 30b RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... The canonical RIPK2 coding sequence (NM_003821) and MKK7 (i.e., MAP2K7) coding sequence (NM_145185.4) were amplified by PCR from a RIPK2 vector (Origene, #RG202530) and a MKK7 vector (GenScript ...
-
bioRxiv - Biochemistry 2019Quote: ... the coding region for full-length human GCP2 (amino acids 1-902) was amplified by PCR using its cDNA as template (NM_001256617.1, Origene). The mTagBFP (blue fluorescent protein ...
-
bioRxiv - Microbiology 2021Quote: The open reading frame of human MIF was amplified by PCR from the vector pCMV6-entry MIF (Origene) and cloned into the pET11a vector (Novagen ...
-
C53 interacting with UFM1-protein ligase 1 regulates microtubule nucleation in response to ER stressbioRxiv - Cell Biology 2020Quote: ... the coding sequence without stop codon was amplified by PCR from the Myc-DDK-tagged CDK5RAP3 (tv3) plasmid (Origene Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... hnRNPUL1 (NM_007040) and PEG10 (NM_015068.3) were PCR amplified from ORF clones (hnRNPL, GenScript #OHu14072; hnRNPUL1, Origene #RC200576; PEG10, GenScript #OHu101111) and the products were cloned into the mammalian expression plasmid pCAGGS ...
-
bioRxiv - Developmental Biology 2021Quote: A synthetic DNA construct encoding mouse ACVR1 with the R206H mutation (G to A at nucleotide position 617) was assembled from synthetic oligonucleotides and PCR products and cloned into the pCMV6 entry mammalian expression vector (Origene), which also encodes a neomycin resistance marker ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid pCMV6-AC-GFP-rtTA-APE1 (for WT tGFP-APE1 protein) was prepared by PCR full-length APE1 from pET28HIS-hAPE1 and subcloned into pCMV6-AC-GFP-rtTA vector (Origene #PS100125) at AscI and RsrII sites ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse Irx3 (NM_008393) was amplified by PCR from the donor vector pCMV6-entry-Irx3-myc-DDK (cat. no MR208149, Origene, Rockville, MD, USA) with the following forward 5’-CGATCTAAGTAAGCTTCACCATGTCCTTCCCCCAGCTCG-3’ and reverse 5’-GATCTTGGCAAAGCTTAGACGAGGAGAGAGCTGATAAGACC-3’ primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... containing the Tantalus domain and SLiM sequence by PCR amplification of the required coding region with insertion into pCMV6-AC-Myc-DDK (Origene, Rockville, MD, USA) using an In-Fusion HD Cloning Plus kit (Takara Bio ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA construct was generated by PCR-amplification on the pCMV6-XL5-human full-length SORL1 cDNA plasmid (pCMV6-XL5-WT-SorLAFL OriGene Technologies, Inc, Rockville, MD, USA) using the 5’ CCGGAATTCCGGCAAAATGGCGACACGGAGCAGCAGG 3’ and 5’ TGCTCTAGAGCACTACTCGTTCTCTTCTGCCAGGGG 3’ oligonucleotides ...