Labshake search
Citations for Origene Technologies :
51 - 100 of 406 citations for Recombinant Human Serpin Peptidase Inhibitor Clade B ovalbumin Member 9 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... THEM6 human tagged ORF clone overexpressing plasmid and respective control (RC201709 and PS100001, Origene, Rockville, MD, USA) were purchased from Origene ...
-
bioRxiv - Cancer Biology 2020Quote: ... LNCaP cells were transfected with SLFN5 (NM_144975) Human MYC-Tagged ORF Clone (RC216330, Origene, Rockville, MD, USA) or the corresponding empty vector plasmid (PS100001 ...
-
bioRxiv - Physiology 2021Quote: ... Full-length human (RC211179) and mouse GCGR (MR207767) both Myc-DDK-tagged cDNA were obtained from OriGene Technologies ...
-
bioRxiv - Bioengineering 2020Quote: ... to transfect GFP-tagged human tumor necrosis factor receptor superfamily 10b (GFP-TNFRSF10B/GFP-DR5) plasmid (OriGene) into the cell lines ...
-
bioRxiv - Cancer Biology 2020Quote: Site-directed mutagenesis was performed using 50ng of KAT3A / CBP (CREBBP) (NM_004380) Human Tagged ORF Clone (OriGene) as the dsDNA template ...
-
bioRxiv - Genomics 2021Quote: Full length human CHD4 tagged at C-terminus with Flag/Myc construct was obtained from Origene (RC224232). Full-length human GATA4 cDNA was amplified with 5’ primer (ATTAGCGATCGCCATGTATCAG ...
-
bioRxiv - Cell Biology 2022Quote: ... C-terminally mGFP-tagged human NRAS in pLenti-C-mGFP was purchased from OriGene (OriGene cat# RC202681L2). C-terminal mGFP was removed and eGFP tag was cloned onto the N-terminus after aberrant localization was observed upon expression in MV3 cells (presumably due to steric inhibition of C-terminal palmitoylation and farnesylation domains by the C-terminal mGFP tag) ...
-
bioRxiv - Neuroscience 2022Quote: ... Myc-DDK tagged wild type human α-synuclein (Myc-α-SYN) plasmid constructs were purchased from OriGene technologies ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid containing human Sirt3102-399 (pEX-His-hSIRT3102-399) was purchased from OriGene (Rockville, MD).
-
bioRxiv - Cell Biology 2020Quote: ... Recombinant human Lsm12-expression plasmids were obtained either commercially (pCMV-Lsm12-Myc-FLAG from OriGene) or were constructed with pcDNA6 (pCDNA6-Lsm12-FLAG-His) ...
-
bioRxiv - Biochemistry 2023Quote: Human cell derived recombinant eIF2A-FLAG was expressed in HEK293T cells obtained commercially (OriGene # TP304303) and buffer exchanged into Protein Storage Buffer (25 mM Tris-HCl ...
-
bioRxiv - Genetics 2020Quote: TMEM43 (Myc-DDK-tagged)-Human transmembrane protein 43 (TMEM43) (GenBank accession no. NM_024334.2) was purchased from OriGene (RC200998) and cloned into CMV-MCS-IRES2-EGFP vector using BglII/XmaI sites ...
-
bioRxiv - Immunology 2021Quote: pCMV6-Entry vector encoding Myc-DKK-tagged human wild type (WT) ATAD3A cDNA (NM_018188.4, Q9NV17-1) was obtained from Origene and mutations were inserted by site-directed mutagenesis using the Q5 kit (E0554S ...
-
bioRxiv - Cancer Biology 2023Quote: ... were transformed by heat shock in 42°C water bath using SETD2 Human Tagged ORF Clone (Origene, RG224760) or pCMV6□AC□GFP Mammalian Expression Vector (Origene ...
-
bioRxiv - Biochemistry 2020Quote: ... The plasmid containing human Sirt3,102-399 (pEX-His-hSIRT3,102-399) was purchased from OriGene (Rockville, molecular dynamics).
-
bioRxiv - Bioengineering 2021Quote: Genes encoding NL-Gal3 (IDT, Coralville, IA, USA) and recombinant human Gal3 (OriGene, Rockville, MD, USA) were inserted into pET-21d(+ ...
-
bioRxiv - Cancer Biology 2020Quote: ... 22Rv1 SLFN5 KO cells were further transfected with SLC7A5 (NM_003486) Human Tagged ORF Clone (RC207604, Origene, Rockville, MD, USA). Cells were then clonally selected ...
-
bioRxiv - Cell Biology 2021Quote: ... NPC1 human fibroblasts were transfected with either eGFP-Vector (pCMV6-AC-GFP Tagged Cloning Vector, Cat #PS100010, Origene Technologies) or eGFP-HSP40 (DNAJB11 (NM_016306 ...
-
bioRxiv - Biochemistry 2022Quote: ... HEK293-Klotho cells were seeded at density of 500 000 cells/well on 6-well tissue culture plates and transfected with RhoGDI1 (ARHGDIA) (NM_004309) Human Tagged ORF Clone (RG200902 OriGene) using Lipofectamine 3000 Transfection Reagent (L3000015 Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: Lenti-X 293T cells were transiently transfected with a CITED2 (NM_001168388) human c-Myc and DYKDDDDK (DDK) tagged open reading frame clone (RC229801, Origene) using Attractene in DMEM medium supplemented with 100 U/ml penicillin ...
-
bioRxiv - Neuroscience 2023Quote: Expression vectors of Myc-DDK-tagged human ORF clones of ANKS1B and SYNGAP1 were purchased from Origene (#RC211877, #RC229432). V5-epitope or GFP-tagged mutants were cloned into the same expression backbone ...
-
bioRxiv - Genetics 2019Quote: ... Shox2 (Myc-DDK-tagged) and Control (Myc-DDK-tagged) were purchased from Origene. To transduce the ATDC5 cells ...
-
bioRxiv - Cancer Biology 2019Quote: ... pCMV6-AC Tagged Cloning mammalian vector with non-tagged expression (Origene, CAT#: PS100020), KDELR3 transcript variant 2 (NM_016657 ...
-
bioRxiv - Cell Biology 2021Quote: Constructs of individual c-myc tagged human TRAP subunits (α, β, δ) under the CMV promotor were purchased from OriGene Technologies (#RC202408 ...
-
bioRxiv - Molecular Biology 2024Quote: NSC34 and HEK293T cells were transfected with a plasmid coding for the hnRNPA2B1 (NM_002137) Human Tagged ORF Clone (Origene, RC219318) using Lipofectamine™ 3000 Transfection Reagent (Invitrogen L3000001) ...
-
bioRxiv - Cell Biology 2021Quote: rKLK10 (500 ng, described above) was incubated with wild-type human recombinant (rHTRA1) (500 ng, Origene TP322362) or kinase-inactive rHTRA1 containing an S328A mutation (500 ng Origene TP700208 ...
-
bioRxiv - Neuroscience 2020Quote: Neurons were transfected at 12 days in vitro (DIV) with PSD95-GFP (a kind gift from David Bredt [49] and FLAG-tagged Human SRXN-1 (purchased from Origene: RC207654) for 5 h using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells (3×106 cells) were seeded in a 10 cm dish and transfected with 6 μg of FLAG-tagged human CREBBP plasmids (Origene,USA) using Metafectene (Biontex ...
-
bioRxiv - Cancer Biology 2020Quote: Three unique 27mer RELA human siRNA oligo dupliexes (SR304030A, B and C) were obtained from Origene (SR304030). Universal scrambled negative control siRNA duplex (SR30004 ...
-
bioRxiv - Physiology 2023Quote: ... were transiently transfected as described above with a plasmid encoding C-terminal Myc-FLAG epitope-tagged human TMEM65 (TMEM65-Myc-FLAG) (Origene #RC207368; NM_194291). Cells were transfected with empty pCMV6-Entry vector (Origene #PS100001 ...
-
bioRxiv - Cell Biology 2020Quote: Myc-Flag-tagged SOX9 (PS100016 Origene) and 6x-HIS-tagged-HOXB2 (Addgene 8522 ...
-
bioRxiv - Cancer Biology 2021Quote: Lentiviral GFP tagged vector (Origene #100093) and human IL-1β (Origene #RC202079L4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Murine tagged Six2 (OriGene CAT# MG20410) and Six3 (OriGene CAT# MR204911 ...
-
bioRxiv - Immunology 2024Quote: ... C-terminal flag-tagged ZFP36L2 (Origene) was cloned into the pMIG-W vector (67 ...
-
bioRxiv - Cell Biology 2023Quote: A recombinant hCABS1 overexpression lysate (OEL) produced in Human Embryonic Kidney 293T (HEK293T) cells (OriGene Technologies Inc., Rockville, MD, USA) was used as a positive control in WB ...
-
bioRxiv - Cancer Biology 2020Quote: BT088 cells were transduced with 4 SMPD3 human shRNA lentiviral particles (A,B,C,D) and Lenti shRNA Scramble control particles (pGFP-c-shLenti; TL301492V; Origene). Transduced GFP+ cells (shSMPD3-GFP variants B,D and shScrambled-GFP ...
-
bioRxiv - Genetics 2022Quote: ... and for WDR60p.Ala911Val mutant cells were transfected with WDR60 Mouse Myc-DDK-tagged tagged ORF Clone (MR217536, Origene, Maryland, USA). After 24 h cells were treated with 10µM monensin and immunofluorescence analysis was done as explained above ...
-
bioRxiv - Neuroscience 2019Quote: ... GFP-tagged Kv4.2 (Cat# MG209597) and Myc-tagged Kv4.3 (Cat# MR221003) expression constructs were purchased from OriGene (Rockville, MD, USA).
-
bioRxiv - Cancer Biology 2019Quote: WM-46 cells stably transduced with FLAG-tagged KDELR3-001 (ENST00000216014) were transfected with GFP-tagged AMFR construct (Origene, RG209639) using FuGENE® HD transfection reagent as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... The oligoribonucleotides were incubated with either 10 µg HuR overexpressing HeLa cell whole cell extracts or 25-200 µM ELAVL1 human recombinant protein (Origene, Rockville, MD) in a 20 µL reaction mixture with 20 units of RNasin and 1X RNA binding buffer containing 20 mM HEPES (pH 7.6) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Myc-DDK-tagged PEX19 (OriGene Technologies, RC201756) using Lipofectamine 2000 (Invitrogen ...
-
ANGPTL8 R59W variant influences inflammation through modulating NF-κB pathway under TNFα stimulationbioRxiv - Biochemistry 2023Quote: ... Myc tagged pCMV6 vector (OriGene, Rockville, MD, USA) was used as control for the transfection experiments ...
-
bioRxiv - Developmental Biology 2024Quote: ... Lmx1b Mouse Tagged ORF Clone plasmids (ORIGENE, MG226016) were transfected using Lipofectamine LTX Reagent with PLUS Reagent (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... DDK-MYC tagged RBFOX2 cDNAs were purchased from Origene in pCMV6-Entry vector (Cat ...
-
bioRxiv - Neuroscience 2023Quote: Plasmids (Myc-tagged TSPO (‘TSPO-Myc’; catalogue # RC220107, OriGene) or a pCMV EV control (catalogue # PS100001 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Carbonic anhydrase 9 (CA9) construct was designed by Origene based on the sequence( Accession Number:NM_001216 ...
-
bioRxiv - Cancer Biology 2020Quote: ... or control recombinant protein CENPA (Origene) at 0.5 ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... NY-ESO-1 recombinant protein (Origene) at 0.5 ug/ml ...
-
bioRxiv - Physiology 2022Quote: Recombinant protein STK25 (0.5μM, TP303215, OriGene) and PRKAR1A (1μM ...
-
bioRxiv - Immunology 2024Quote: ... with recombinant TSP-1 (Origene, USA) at a concentration of 100ng/ml ...