Labshake search
Citations for Origene Technologies :
51 - 100 of 406 citations for Recombinant Human CD3D & CD3E Flag Fc & His Fc tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The OGT lentiviral vector was produced by first cloning OGT with C-terminal FLAG and HA tags into the pCMV6 entry vector (Origene, Rockville, MD) using the NEBuilder HiFi DNA assembly and Q5 site-directed mutagenesis kits according to the manufacturer’s protocols ...
-
bioRxiv - Physiology 2020Quote: ... Human Flag- and myc-tagged GPT and GPT2 cDNA was obtained from Origene (RC203756 and RC209119). Mutagenesis of Ser126 to Arg in GPT and Ser153 to ARg in GPT2 was performed with the Q5 site-directed mutagenesis kit frm NEB (#E0554).
-
bioRxiv - Physiology 2020Quote: ... Human Flag- and myc-tagged GPT and GPT2 cDNA was obtained from Origene (RC203756 and RC209119). Mutagenesis of Ser125 to Arg in GPT and Ser153 to Arg in GPT2 17 was performed with the Q5 site-directed mutagenesis kit from NEB (#E0554) ...
-
bioRxiv - Cell Biology 2021Quote: rKLK10 (500 ng, described above) was incubated with wild-type human recombinant (rHTRA1) (500 ng, Origene TP322362) or kinase-inactive rHTRA1 containing an S328A mutation (500 ng Origene TP700208 ...
-
bioRxiv - Immunology 2024Quote: mRNA was synthesized encompassing the open reading frame of a fusion protein coding for the full-length ANKRD55 isoform 201 coupled to C-terminal MYC-FLAG tags as provided by a commercial vector (Origene, Cat. No. RC221211). Unmodified synthesized ANKRD55 mRNA transcript was capped at the 5’ end using wild-type bases CleanCap® AG (TriLink BioTechnologies ...
-
bioRxiv - Physiology 2023Quote: Mammalian expression plasmid encoding human TMEM263 with a C-terminal epitope tag (Myc-DDK) was obtained from Origene (RC203933). Control pCDNA3.1 empty plasmid was obtained from Invitrogen ...
-
bioRxiv - Genomics 2021Quote: Full length human CHD4 tagged at C-terminus with Flag/Myc construct was obtained from Origene (RC224232). Full-length human GATA4 cDNA was amplified with 5’ primer (ATTAGCGATCGCCATGTATCAG ...
-
bioRxiv - Cancer Biology 2019Quote: Recombinant Myc-Flag-RNF114 proteins were either purified from HEK292T cells as described above or purchased from Origene (Origene Technologies Inc., TP309752). For in vitro auto-ubiquitination assay ...
-
bioRxiv - Cell Biology 2022Quote: ... Human ACLY(H760A) was generated by site-directed mutagenesis using the pCMV6-ACLY(MYC-FLAG) vector (Origene, RC200508). Human CPα (CAPZA1 ...
-
bioRxiv - Physiology 2023Quote: ... DDK tag (Origene, TA50011-100), Histone 3 (abcam ...
-
bioRxiv - Cell Biology 2023Quote: A recombinant hCABS1 overexpression lysate (OEL) produced in Human Embryonic Kidney 293T (HEK293T) cells (OriGene Technologies Inc., Rockville, MD, USA) was used as a positive control in WB ...
-
bioRxiv - Genetics 2020Quote: ... ACE2 with C-terminal GFP-tag (RG208442) and Myc-DDK tag (RC208442) were purchased from Origene. Empty vectors pMax-GFP (Lonza ...
-
bioRxiv - Neuroscience 2020Quote: Neurons were transfected at 12 days in vitro (DIV) with PSD95-GFP (a kind gift from David Bredt [49] and FLAG-tagged Human SRXN-1 (purchased from Origene: RC207654) for 5 h using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells (3×106 cells) were seeded in a 10 cm dish and transfected with 6 μg of FLAG-tagged human CREBBP plasmids (Origene,USA) using Metafectene (Biontex ...
-
bioRxiv - Genomics 2023Quote: ... The oligoribonucleotides were incubated with either 10 µg HuR overexpressing HeLa cell whole cell extracts or 25-200 µM ELAVL1 human recombinant protein (Origene, Rockville, MD) in a 20 µL reaction mixture with 20 units of RNasin and 1X RNA binding buffer containing 20 mM HEPES (pH 7.6) ...
-
bioRxiv - Cancer Biology 2022Quote: ... pCMV6-FLAG-CD44 (OriGene) and pCMV3-HA-CD81 (Sino Biological ...
-
bioRxiv - Microbiology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA); the goat anti-mouse MSR1 (Cat# AF1797) ...
-
bioRxiv - Immunology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA). The mouse anti-human MSR1 (Cat# MAB2708 ...
-
bioRxiv - Neuroscience 2021Quote: ... FLAG-PLP1 (CAT#: RC218616) and FLAG-CNP (CAT#: RC207038) were acquired from Origene, Maryland ...
-
bioRxiv - Microbiology 2020Quote: ... FLAG-tagged MtTop1 was detected with anti-DDK (FLAG) antibodies (Origene, TA50011, 1:2,500). Membranes were incubated with primary antibodies at room temperature for 3 hr ...
-
bioRxiv - Physiology 2023Quote: ... The SIK3-Flag plasmid was constructed by subcloning of a 3xFlag tag to replace the Myc-DDK tag in the mSIK3-Myc-DDK plasmid (MR211912, OriGene). SIK3-Flag-ΔPKA (ΔPKA ...
-
bioRxiv - Cancer Biology 2020Quote: ... or control recombinant protein CENPA (Origene) at 0.5 ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... NY-ESO-1 recombinant protein (Origene) at 0.5 ug/ml ...
-
bioRxiv - Physiology 2022Quote: Recombinant protein STK25 (0.5μM, TP303215, OriGene) and PRKAR1A (1μM ...
-
bioRxiv - Immunology 2024Quote: ... with recombinant TSP-1 (Origene, USA) at a concentration of 100ng/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... A lentiviral RHINO-myc-Flag plasmid (pCMV6-RHNO1-Myc-FLAG) was purchased from Origene (RC203020). Full-length human POLQ cloned into pLPC-Flag vector was previously described (Mateos-Gomez et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... and (iii) ZNF416-FLAG (Origene, Inc). Using Lipofectamine 3000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... anti-DDK (FLAG) antibody (OriGene, #TA150014) or rabbit IgG (Cell Signaling ...
-
bioRxiv - Cell Biology 2020Quote: PORCN-FLAG was obtained from OriGene Technologies Inc ...
-
bioRxiv - Cell Biology 2020Quote: Myc-Flag-tagged SOX9 (PS100016 Origene) and 6x-HIS-tagged-HOXB2 (Addgene 8522 ...
-
bioRxiv - Immunology 2024Quote: ... C-terminal flag-tagged ZFP36L2 (Origene) was cloned into the pMIG-W vector (67 ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant protein DHX36 was purchased from OriGene Technologies Inc ...
-
bioRxiv - Microbiology 2020Quote: ... Mouse anti-Myc-tag (9E10) was purchased from Origene; Rabbit anti-GM130 was purchased from Abcam ...
-
bioRxiv - Cancer Biology 2022Quote: ... pCMV-CIC with myc-tag was purchased from Origene and validated previously.
-
bioRxiv - Neuroscience 2023Quote: ... we used a plasmid containing SNX27-FLAG under CMV promoter (pCMV-SNX27-FLAG, OriGene Technologies plasmid #MR218832). For SNX27 knockdown experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-Flag (Origene, TA50011, 1:1,000), goat anti-Flag (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... pCMV6-Entry HDGF-Myc-Flag (OriGene, RC204148), and cytHDGF-Myc-Flag ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-Flag (Origene, TA50011, 1:1,000), goat anti-ChAT (Chemicon ...
-
bioRxiv - Cell Biology 2022Quote: ... SEC11A-Myc-FLAG was obtained from OriGene Technologies (#RC204971).
-
bioRxiv - Immunology 2024Quote: ... ZFAND6-Flag-Myc was purchased from Origene. pEBB-HA cIAP1 was a gift from Colin Duckett (Addgene plasmid# 38232 ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse mAb anti-6xHis tag (clone HIS.H8) was from OriGene Technologies ...
-
bioRxiv - Neuroscience 2022Quote: Plasmids: HA-tags were attached to mouse VASH1 (Origene, MR222520) and VASH2 (Origene ...
-
bioRxiv - Genetics 2020Quote: ... and exposed to either FLAG-specific (Origene, #TA50011) or actin (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1:1000 Anti-DDK (FLAG) Clone 4C5 (OriGene Cat# TA50011-100 ...
-
bioRxiv - Cancer Biology 2021Quote: ... plasmids were purchased from Addgene and MYC/FLAG-hIMPDH2 (#RC202977) plasmid from Origene. EZH2 (1-170) ...
-
Ribosomal quality control factors inhibit repeat-associated non-AUG translation from GC-rich repeatsbioRxiv - Molecular Biology 2023Quote: ... pCMV6-hANKZF1-Myc-FLAG was purchased from Origene, RC201054 ...
-
bioRxiv - Cell Biology 2020Quote: Recombinant full-length WNK1 (residues 1-2382; OriGene, RC214240) was expressed with a C-terminal Myc-DDK tag from a pCMV6-Entry backbone in Expi 293F suspension cells (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant proteins were purchased commercially: NOTCH1 (Origene, Cat# TP762041), CDH6 (ACROBiosystem ...
-
bioRxiv - Cancer Biology 2023Quote: ... biosensors were exposed to recombinant Arc protein (TP304129, OriGene) solution in the assay buffer at a concentration of 30 µg mL-1 of for 130 s ...
-
bioRxiv - Cancer Biology 2021Quote: ... RAW 264.7 cells were treated with 5 ng/ml murine recombinant IL-18 protein or 5 ng/mL murine recombinant IL-20 protein (Origene, Rockville, MD, USA) for 72 hours ...