Labshake search
Citations for Origene Technologies :
51 - 100 of 351 citations for Rat ERICH6 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: Cells expressing shMdm2 or shScramble were sorted for GFP positive cells and transduced with lentivirus carrying a pool of shRNAs against Sprouty4 (4 different shRNAs purchased from OriGene, cat.#HC108594) or shScramble sequence as control (OriGene ...
-
bioRxiv - Cancer Biology 2023Quote: ... HT1080 p53KO cells were transduced with lentivirus carrying a pool of shRNAs against Mdm2 (4 different shRNAs purchased from OriGene, cat.#TL311529) or shScramble sequence as control (OriGene ...
-
bioRxiv - Microbiology 2020Quote: ... pRS-derived retroviral vectors expressing a scramble shRNA and shRNA targeting the mRNA of human LY6E were obtained from OriGene (Cat. No. TR311641).
-
bioRxiv - Cell Biology 2019Quote: ... OVCA429 cells were transfected with GFP-mDia2 shRNA constructs (Origene) using Fugene (Promega (Madison ...
-
bioRxiv - Cell Biology 2019Quote: ... and mDia2 shRNA and control pGFPVRS from Origene (Rockville, MD) respectively.
-
bioRxiv - Neuroscience 2023Quote: ... or vector encoding non-targeting shRNA (shControl; TR30021, OriGene Technologies) were packed in LV by cotransfection with psPAX2 (gift from Didier Trono ...
-
bioRxiv - Cancer Biology 2023Quote: ... siCOP1 and shRNAs against Cul9 and ATG5 were from Origene, shCOP1 was from Santa Cruz Biotechnology ...
-
bioRxiv - Biochemistry 2021Quote: All shRNA constructs for MICS1 and LETM1 were obtained from Origene Technologies (Rockville ...
-
bioRxiv - Neuroscience 2021Quote: ... were applied and scrambled shRNA was used as control (OriGene, #TR30021). For overexpression experiments ...
-
bioRxiv - Cancer Biology 2020Quote: PGC1α (encoded by PPARGC1A) was knocked-down with shRNA constructs (TG310260, Origene) in LNCaP cells (LNCaP_shPGC1A ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were infected with lentiviral carrying shRNA specific to DCP1a (OriGene) or DCP1b (OriGene ...
-
bioRxiv - Cancer Biology 2019Quote: ... shWRNIP1 cell line was generated by stably expressing shRNA against WRNIP1 (shWRNIP1) (OriGene). Cells were cultured in the presence of puromycin (100 ng/ml ...
-
bioRxiv - Genomics 2019Quote: ... pGFP-C-shRNA-Lenti-B2M and pGFP-C-scrambled were purchased from Origene. The packaging vectors PmD2G and PsPAX.2 were obtained from Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ShRNA for canine synaptopodin cloned into puromycin-selectable pRS mammalian expression vector (Origene) has previously been described (Kannan and Tang ...
-
bioRxiv - Cell Biology 2019Quote: We used a short hairpin RNA (shRNA, 29-mer; OriGene Technologies, Rockville, MD) expression vector that effectively down-regulates TMEM163 expression as we previously reported (Eichelsdoerfer et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... and MK5 specific shRNA construct in lentiviral GFP vector were purchased from Origene (Rockville ...
-
bioRxiv - Immunology 2022Quote: ... HC108542B–AGTTGTGTTGTCCAGTTTCCTGTCCATGC and scrambled negative control non-effective shRNA (Origene Item no: TR30023). Lentivirus was packaged by co-transfecting shRNA and psPAX2 and pVSVG packaging plasmids into HEK293T cells ...
-
bioRxiv - Cancer Biology 2021Quote: shRNAs constructs targeting human or mouse ATRX were obtained from OriGene (Rockville, MD, USA). The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A ...
-
bioRxiv - Cell Biology 2021Quote: ... A nontargeting 29-mer scrambled shRNA cassette in pGFP-C-shLenti vector (TR30021, OriGene) served as a control ...
-
bioRxiv - Cancer Biology 2019Quote: ... To knock down 4E-BP1 we used pGFP-V-RS EIF4EBP1 Human shRNA (OriGene) versus scramble and control vector ...
-
bioRxiv - Neuroscience 2022Quote: ... A 29-mer scrambled shRNA cassette in the pGFP-C-shLenti vector (TR30021; Origene) was used as the off-target control ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were transduced with a set of 4 shRNAs against Spry4 (OriGene, cat.#HC108594) or shRNA negative control (OriGene ...
-
bioRxiv - Neuroscience 2021Quote: ... hippocampal neurons were treated at DIV 3 with AAV1mCherry-pU6-Kv2.1 shRNA designed by OriGene (target sequence ...
-
bioRxiv - Neuroscience 2020Quote: B2M was knocked down using lentiviral particles containing B2M-targeting shRNA (OriGene, TL314543V, Virus A). Non-targeting scramble shRNA from the same kit was used as control ...
-
bioRxiv - Neuroscience 2022Quote: ... were cloned into HuSH shRNA GFP AAV Cloning Vector (pGFP-A-shAAV Vector; TR30034, Origene). The efficiency of the specific Opn3 shRNA was tested in HEK293T/17 cells (human embryonic kidney cell line ...
-
Tumour Extracellular Vesicles Induce Neutrophil Extracellular Traps To Promote Lymph Node MetastasisbioRxiv - Cancer Biology 2023Quote: B16F10 cells were transfected with Rab27a-mouse shRNA and scramble RNA lentiviral particles purchased from Origene according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... For knockdown experiments four pGFP-C-shLenti vectors containing different shRNAs against Skap2 (Origene; see Table 1) were applied and scrambled shRNA was used as control (OriGene ...
-
bioRxiv - Cell Biology 2021Quote: ... Goat anti-Rat IgG (OriGene Technologies, U.S.) and anti-Rab IgG secondary rabbit antibody (OriGene Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-CCT1 (1:200 dilution, Origene), mouse anti-CCT5 (1:200 dilution ...
-
bioRxiv - Neuroscience 2021Quote: ... shRNA scrambled control and KIF13A knockdown constructs (shCtrl, shKIF13A1 and A2, KIF13B) were purchased from Origene (catalog #TL706020). The KIF13B knockdown construct was a gift from Dr ...
-
bioRxiv - Cell Biology 2019Quote: ... ShRNA sequences specific for hERG1a 5’-GCGCAGCGGCTTGCTCAACTCCACCTCGG-3’ and its control 5’-GCACTACCAGAGCTAACTCAGATAGTACT-3’ were provided by Origene into a pGFP-V-RS vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stable cell lines were stablished transducing cells with a set of 4 shRNAs against Mdm2 (Origene, cat.#TL311529) or shRNA negative control (Origene ...
-
bioRxiv - Cell Biology 2019Quote: Plasmids included pCMV6-AC-IL2R-GFP (Origene plasmid #RG215768). pHR-SFFV-dCas9-BFP-KRAB ...
-
bioRxiv - Neuroscience 2020Quote: ... and scrambled control shRNA cassette in pGFP-V-RS Vector (Cat#TR30013) were purchased from Origene (Rockville, MD, USA). Lipofectamine™ stem transfection reagent (Cat#STEM00003 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and plasmid (OriGene) transfection was performed following the manufacturer’s protocol (Qiagen ...
-
bioRxiv - Cell Biology 2019Quote: ... and shRNAs against mouse DNMBP cloned into the pRFP-C-RS vector (TF515449, Locus ID 71972) were purchased from OriGene. Cdc42F28L-HA was provided by Richard A ...
-
bioRxiv - Cancer Biology 2019Quote: Replication incompetent lentivirus were produced in HEK 293T cells co-transfected by mixing 5 µg of either pLKO.1 Empty Vector or pLKO.1 shRNA targeting SMARCD3 with 6 µg Lenti-vpak packaging kit components (OriGene) and 33 µL of transfection reagent (OriGene ...
-
bioRxiv - Cancer Biology 2021Quote: CT-2A and GL261 glioma cell lines were infected with Slit2 mouse shRNA lentiviral particles (Locus ID 20563, Origene TL511128V) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... pGFP-C-shLenti scrambled negative control (TR30021), and pGFP-C-shLenti Lphn3 shRNA-D (GTATGTTGGCTTCGCCTTGACACCTACTT, custom) were purchased from Origene.
-
bioRxiv - Cell Biology 2023Quote: ... ATAGAGCGTGCGGATAATGACAAGGAGTA), Synaptojanin 2 shRNA in pRFP-C-RS vector (cat. no. FI732825, TGTGCCTCTGCGGCAGCACCAGGTGAACT and FI732826, TTGTGGAGACAGAGCAGGCGATTTACATG) were purchased from Origene. Constructs of the following proteins were kind gifts ...
-
bioRxiv - Microbiology 2021Quote: ... TMPRSS2 human plasmid (Origene) was transfected using X-tremeGENE HP Transfection Reagent (Merck ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP plasmid (#PS100065; Origene). In preliminary experiments ...
-
bioRxiv - Microbiology 2021Quote: ... TMPRSS2 human plasmid (Origene) was transfected using X-tremeGENE HP Transfection Reagent (Merck ...
-
bioRxiv - Neuroscience 2022Quote: Stable knockdown of Cebpg in 50B11 cells was done by transfecting 50B11 cells with pGFP-C-shLenti carrying shRNA against Cebpg (1µg/ml; TL709448; Origene, Rockville, MD) following manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: ... pCMV6-XL5 empty plasmid (PCMV6XL5) and S100A7 plasmid were purchased from Origene (#SC122639). RAGE plasmid was purchased from Sino Biological (HG11629-ACG) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... MG87.TRKB cells were transfected with a mix of 4 AP2M specific shRNA sequences (#TG712191, Origene, USA or scrambled sequence as control) using Lipofectamine 2000 (#11668019 ...
-
bioRxiv - Biochemistry 2020Quote: Viral vectors expressing lentiviral particles with 4 unique 29mer target-specific shRNA (A/B/C/D) to murine PRDX4 and 1 scramble control (non-specific or NS) were purchased from Origene (Rockville, MD). MIN6 cells were seeded on 48 well plates and cultured overnight in 0.3 mL medium ...
-
bioRxiv - Physiology 2021Quote: ... medium was replaced by serum-free OptiMEM and cells were transfected with Septin-7-specific shRNA constructs in retroviral pGFP-V-RS vectors (Origene, Cambridge, UK) using Lipofectamine 2000 transfection reagent ...
-
bioRxiv - Cancer Biology 2019Quote: ... LMTK3 plasmids (Origene, Rockville, MD) were transfected into cells using Lipofectamine 2000 reagent (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... RBM3-GFP plasmid from Origene was used (Origene MG201130).