Labshake search
Citations for Origene Technologies :
51 - 100 of 475 citations for Mouse KIF26B shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... The shRNA against PLD2 was provided by Origene.
-
bioRxiv - Cell Biology 2023Quote: ... scrambled shRNA (TR30012, OriGene Technologies Inc, Rockville, MD) was used instead ...
-
MIIP downregulation promotes colorectal cancer progression via inducing adjacent adipocytes browningbioRxiv - Cancer Biology 2023Quote: ... Human CD36 or control shRNA constructs (Origene, TR314090) were transfected into parental HCT116 cells using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: Plasmid encoding myc-tagged mouse MARCKS was purchased from Origene. Plasmid encoding HA-PKCα was a gift from Bernard Weinstein (Addgene plasmid #21232) ...
-
bioRxiv - Neuroscience 2022Quote: Plasmids: HA-tags were attached to mouse VASH1 (Origene, MR222520) and VASH2 (Origene ...
-
bioRxiv - Cancer Biology 2023Quote: Cells expressing shMdm2 or shScramble were sorted for GFP positive cells and transduced with lentivirus carrying a pool of shRNAs against Sprouty4 (4 different shRNAs purchased from OriGene, cat.#HC108594) or shScramble sequence as control (OriGene ...
-
bioRxiv - Cancer Biology 2023Quote: ... HT1080 p53KO cells were transduced with lentivirus carrying a pool of shRNAs against Mdm2 (4 different shRNAs purchased from OriGene, cat.#TL311529) or shScramble sequence as control (OriGene ...
-
bioRxiv - Microbiology 2020Quote: ... pRS-derived retroviral vectors expressing a scramble shRNA and shRNA targeting the mRNA of human LY6E were obtained from OriGene (Cat. No. TR311641).
-
bioRxiv - Neuroscience 2020Quote: The plasmid encoding AAV-PGK-chst3 was made by amplifying the mouse chst3 sequence from plasmid MR207541 (OriGene) via the primers 5’ GGAATTCATAGGGCGGCCGGGAA 3’ and 5’ AGCGCTGGCCGGCCGTTTAAAC 3’ and was cloned into plasmid AAV-PGK-Cre (Addgene plasmid # 24593 ...
-
bioRxiv - Genetics 2020Quote: Mouse expression plasmids containing cDNA encoding Rhbdf1 was obtained from OriGene. The Q5® Site-Directed Mutagenesis Kit was used to introduce site-specific mutations in the mouse Rhbdf1 plasmid according to the manufacturer’s instructions and confirmed by Sanger sequencing ...
-
bioRxiv - Neuroscience 2022Quote: Short interference mouse PCBP1 RNAi plasmids were purchased from Origene (TL502540). Lentiviral particles expressing the PCBP1 shRNAi or scramble control were produced by the VirusTech Core Facility ...
-
bioRxiv - Physiology 2022Quote: ... The mouse RUNX2-Myc/DDK plasmid was purchased from OriGene (MR227321), then subcloned into pLV-EF1a-IRES-Hygro (Addgene #85134) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The mouse Runx2 plasmid pCMV-Flag-mRunx2 was purchased from Origene. The fragments shown in Fig ...
-
bioRxiv - Cell Biology 2019Quote: ... OVCA429 cells were transfected with GFP-mDia2 shRNA constructs (Origene) using Fugene (Promega (Madison ...
-
bioRxiv - Cell Biology 2019Quote: ... and mDia2 shRNA and control pGFPVRS from Origene (Rockville, MD) respectively.
-
bioRxiv - Neuroscience 2023Quote: ... or vector encoding non-targeting shRNA (shControl; TR30021, OriGene Technologies) were packed in LV by cotransfection with psPAX2 (gift from Didier Trono ...
-
bioRxiv - Cancer Biology 2023Quote: ... siCOP1 and shRNAs against Cul9 and ATG5 were from Origene, shCOP1 was from Santa Cruz Biotechnology ...
-
bioRxiv - Immunology 2021Quote: The mouse CD8a and CD8b plasmids were purchased from Origene (Rockville, MD). Catalog numbers MR227539 and MR225204 ...
-
bioRxiv - Cell Biology 2020Quote: ... A Myc-Flag-tagged mouse Activin expression plasmid was purchased from Origene Technologies (MR225191) ...
-
bioRxiv - Cell Biology 2021Quote: ... The mouse AP-3μ1 expression plasmid was purchased from Origene (Ref. MR206629) and consists of AP-3μ1-myc-DDK in pCMV6-ENTRY ...
-
bioRxiv - Biochemistry 2021Quote: All shRNA constructs for MICS1 and LETM1 were obtained from Origene Technologies (Rockville ...
-
bioRxiv - Neuroscience 2021Quote: ... were applied and scrambled shRNA was used as control (OriGene, #TR30021). For overexpression experiments ...
-
bioRxiv - Developmental Biology 2022Quote: ... for testing were co-transfected with Renilla control plasmid (20 ng) and either a plasmid containing mouse Tbx1 cDNA (200 ng, Origene, PS100001) or empty vector control (200ng ...
-
bioRxiv - Cancer Biology 2020Quote: PGC1α (encoded by PPARGC1A) was knocked-down with shRNA constructs (TG310260, Origene) in LNCaP cells (LNCaP_shPGC1A ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were infected with lentiviral carrying shRNA specific to DCP1a (OriGene) or DCP1b (OriGene ...
-
bioRxiv - Cancer Biology 2019Quote: ... shWRNIP1 cell line was generated by stably expressing shRNA against WRNIP1 (shWRNIP1) (OriGene). Cells were cultured in the presence of puromycin (100 ng/ml ...
-
bioRxiv - Genomics 2019Quote: ... pGFP-C-shRNA-Lenti-B2M and pGFP-C-scrambled were purchased from Origene. The packaging vectors PmD2G and PsPAX.2 were obtained from Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ShRNA for canine synaptopodin cloned into puromycin-selectable pRS mammalian expression vector (Origene) has previously been described (Kannan and Tang ...
-
bioRxiv - Cell Biology 2019Quote: We used a short hairpin RNA (shRNA, 29-mer; OriGene Technologies, Rockville, MD) expression vector that effectively down-regulates TMEM163 expression as we previously reported (Eichelsdoerfer et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... and MK5 specific shRNA construct in lentiviral GFP vector were purchased from Origene (Rockville ...
-
bioRxiv - Immunology 2022Quote: ... HC108542B–AGTTGTGTTGTCCAGTTTCCTGTCCATGC and scrambled negative control non-effective shRNA (Origene Item no: TR30023). Lentivirus was packaged by co-transfecting shRNA and psPAX2 and pVSVG packaging plasmids into HEK293T cells ...
-
bioRxiv - Cell Biology 2021Quote: ... A nontargeting 29-mer scrambled shRNA cassette in pGFP-C-shLenti vector (TR30021, OriGene) served as a control ...
-
bioRxiv - Cancer Biology 2019Quote: ... To knock down 4E-BP1 we used pGFP-V-RS EIF4EBP1 Human shRNA (OriGene) versus scramble and control vector ...
-
bioRxiv - Neuroscience 2022Quote: ... A 29-mer scrambled shRNA cassette in the pGFP-C-shLenti vector (TR30021; Origene) was used as the off-target control ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were transduced with a set of 4 shRNAs against Spry4 (OriGene, cat.#HC108594) or shRNA negative control (OriGene ...
-
bioRxiv - Neuroscience 2021Quote: ... hippocampal neurons were treated at DIV 3 with AAV1mCherry-pU6-Kv2.1 shRNA designed by OriGene (target sequence ...
-
bioRxiv - Neuroscience 2020Quote: B2M was knocked down using lentiviral particles containing B2M-targeting shRNA (OriGene, TL314543V, Virus A). Non-targeting scramble shRNA from the same kit was used as control ...
-
bioRxiv - Neuroscience 2022Quote: ... were cloned into HuSH shRNA GFP AAV Cloning Vector (pGFP-A-shAAV Vector; TR30034, Origene). The efficiency of the specific Opn3 shRNA was tested in HEK293T/17 cells (human embryonic kidney cell line ...
-
bioRxiv - Neuroscience 2024Quote: ... Plasmids encoding mouse KvS subunits with C-terminal myc-DDK tags were obtained from Origene (Kv6.1 (MR223857); Kv6.4 (MR224440) ...
-
bioRxiv - Molecular Biology 2022Quote: H9c2 cells were transfected with plasmid containing DDK-tagged mouse JCN (Accession number: NM_133723, Origene, Rockville, MD, USA) or its mutant (K8R/K102R/K107R/K140R ...
-
bioRxiv - Neuroscience 2021Quote: ... For knockdown experiments four pGFP-C-shLenti vectors containing different shRNAs against Skap2 (Origene; see Table 1) were applied and scrambled shRNA was used as control (OriGene ...
-
bioRxiv - Neuroscience 2020Quote: ... ShRNA sequences against rat Zdhhc3 (5’-GAGACATTGAACGGAAACCAGAATACCTC-3’) and Zdhhc7 (5’-ATGACATGGCTTCTGGTCGTCTATGCAGA-3’) were purchased from Origene and subcloned ...
-
bioRxiv - Neuroscience 2021Quote: ... shRNA scrambled control and KIF13A knockdown constructs (shCtrl, shKIF13A1 and A2, KIF13B) were purchased from Origene (catalog #TL706020). The KIF13B knockdown construct was a gift from Dr ...
-
bioRxiv - Cell Biology 2019Quote: ... ShRNA sequences specific for hERG1a 5’-GCGCAGCGGCTTGCTCAACTCCACCTCGG-3’ and its control 5’-GCACTACCAGAGCTAACTCAGATAGTACT-3’ were provided by Origene into a pGFP-V-RS vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stable cell lines were stablished transducing cells with a set of 4 shRNAs against Mdm2 (Origene, cat.#TL311529) or shRNA negative control (Origene ...
-
bioRxiv - Cell Biology 2019Quote: Plasmids included pCMV6-AC-IL2R-GFP (Origene plasmid #RG215768). pHR-SFFV-dCas9-BFP-KRAB ...
-
bioRxiv - Neuroscience 2020Quote: ... and scrambled control shRNA cassette in pGFP-V-RS Vector (Cat#TR30013) were purchased from Origene (Rockville, MD, USA). Lipofectamine™ stem transfection reagent (Cat#STEM00003 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and plasmid (OriGene) transfection was performed following the manufacturer’s protocol (Qiagen ...
-
bioRxiv - Cancer Biology 2019Quote: Replication incompetent lentivirus were produced in HEK 293T cells co-transfected by mixing 5 µg of either pLKO.1 Empty Vector or pLKO.1 shRNA targeting SMARCD3 with 6 µg Lenti-vpak packaging kit components (OriGene) and 33 µL of transfection reagent (OriGene ...
-
bioRxiv - Cell Biology 2023Quote: ... pGFP-C-shLenti scrambled negative control (TR30021), and pGFP-C-shLenti Lphn3 shRNA-D (GTATGTTGGCTTCGCCTTGACACCTACTT, custom) were purchased from Origene.