Labshake search
Citations for Origene Technologies :
51 - 100 of 410 citations for Killer cell immunoglobulin like receptor 2DL3 KIR2DL3 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... or human GPR87 ORF (Origene, RC218486L3)) for 6 hrs ...
-
bioRxiv - Cancer Biology 2021Quote: ... and human IL-1β (Origene #RC202079L4) plasmid constructs were used for generating stable LNCaP cells ...
-
bioRxiv - Cancer Biology 2020Quote: DUSP1 human overexpression plasmid (Origene, NM_004417) was expanded and transfected into 451Lu BRAFi-R and 1205Lu BRAFi-R cells using jetPRIME® transfection reagent (Polyplus transfection) ...
-
bioRxiv - Cell Biology 2023Quote: ... and Human MTERF (MTERF1) (Origene, TP761846). Proteins injected were serially diluted (two-fold each step ...
-
bioRxiv - Neuroscience 2023Quote: The human GPR37L1 cDNA clone (Origene) was subcloned into pcDNA3.1+ (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: Human CYP4F2-myc-DDK (OriGene RC216427), human
-
bioRxiv - Physiology 2023Quote: Human SLC8B1 cDNA (Origene #RC214624; NM_024959) was PCR amplified using primers to introduce a 5′ AgeI restriction site and a 3′ BamHI restriction site flanking the coding sequence ...
-
bioRxiv - Cell Biology 2023Quote: ... and Human Dlk2 pCMV6 (RC210622, Origene) vectors ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified human recombinant NRXN3 TP323448 (Origene) was used as standard ...
-
bioRxiv - Cancer Biology 2020Quote: ... 22Rv1 SLFN5 KO cells were further transfected with SLC7A5 (NM_003486) Human Tagged ORF Clone (RC207604, Origene, Rockville, MD, USA). Cells were then clonally selected ...
-
bioRxiv - Developmental Biology 2019Quote: The cDNAs of UBE2D3 variants (wt, S138A, S138E, S138D) were cloned into the pET-N-His (Origene) vector containing a 6xHis N-terminal tag ...
-
bioRxiv - Molecular Biology 2021Quote: ... Human p97/VCP (NM_007126, SC125280), human UFD1L (NM_005659, SC320168), and human NPLOC4 (NM_017921, SC113845) expression plasmids were purchased from OriGene.
-
bioRxiv - Neuroscience 2024Quote: ... we cloned human IgLON5 deletion constructs from full-length Myc-DKK-tagged human IgLON5 plasmid (Origene, #225495) using a Q5® Site-Directed Mutagenesis kit (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... transient or tetracyclin-inducible expression of human HEATR5B with an N-terminal GFP tag in human cells) were cloned by Gibson assembly with the full-length human HEATR5B open reading frame (derived from plasmid RC22610 (Origene)) and either pcDNA3.1-eGFP-linker or pcDNA5-FRT/TO-eGFP-linker plasmids (coding for eGFP and a GGSGGSGG linker ...
-
bioRxiv - Cell Biology 2023Quote: A recombinant hCABS1 overexpression lysate (OEL) produced in Human Embryonic Kidney 293T (HEK293T) cells (OriGene Technologies Inc., Rockville, MD, USA) was used as a positive control in WB ...
-
bioRxiv - Molecular Biology 2024Quote: NSC34 and HEK293T cells were transfected with a plasmid coding for the hnRNPA2B1 (NM_002137) Human Tagged ORF Clone (Origene, RC219318) using Lipofectamine™ 3000 Transfection Reagent (Invitrogen L3000001) ...
-
bioRxiv - Biochemistry 2021Quote: ... transiently co-transfected with pcDNA3.1-FIT2/V5-His and GFP-tagged MARCH6 (BC059190) Mouse Tagged ORF Clone (Origene), were pre-treated with 10 µM MG132 (Cell Signaling Technology ...
-
bioRxiv - Cell Biology 2021Quote: ... Human Plaat cDNAs were purchased from ORIGENE [RC208444 for PLAAT1 (NM_020386) ...
-
bioRxiv - Neuroscience 2021Quote: Human cDNA panels were obtained from Origene: TissueScan ...
-
bioRxiv - Biochemistry 2021Quote: ... Human ERβ cDNA was obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Biochemistry 2023Quote: ... and human CYB5R1-myc-DDK (OriGene RC205833L3) plasmids were transiently co-transfected into HEK293T cells using PolyFect (Qiagen 301105 ...
-
bioRxiv - Biochemistry 2023Quote: ... Recombinant pure human 14-3-3σ (Origene) or mutations [12] (0.5 µg) ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then incubated for at least 20 hours at room temperature with a combination of the following primary antibodies in PBS-TX with 2% NGS or NDS: rabbit anti-α5 GABAA receptor subunit (1:200; TA338505, OriGene Tech., Rockville, USA), rabbit anti-α1 GABAA receptor subunit (1:300 ...
-
bioRxiv - Genetics 2022Quote: ... For WDR34p.Arg183Trp and WDR34p.Gly394Ser mutants cells were transfected with WDR34 human Myc-DDK-tagged tagged ORF Clone (RC204288, OriGene, Rockville, Maryland, USA) and for WDR60p.Ala911Val mutant cells were transfected with WDR60 Mouse Myc-DDK-tagged tagged ORF Clone (MR217536 ...
-
bioRxiv - Cancer Biology 2022Quote: GCN2 and ATF4 knock-out cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5’-AATTTAGTTTTGTACCCTCA-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells (3×106 cells) were seeded in a 10 cm dish and transfected with 6 μg of FLAG-tagged human CREBBP plasmids (Origene,USA) using Metafectene (Biontex ...
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... The plasmid encoding human GLUT1 was from OriGene. The haemagglutinin (HA-)tag sequence atcgattatccttatgatgttcctgattatgctgag was inserted at base pair 201 (between amino acids 67 and 68 of the exofacial loop of GLUT1 ...
-
bioRxiv - Cell Biology 2019Quote: ... Human CD31 was obtained from Origene (TrueClone, SC119894). Piezo1 and CD31 pcDNA6 templates were generated by inverse PCR with the Phusion® DNA polymerase (New England Bio Labs) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Recombinant pure human proteins were purchased from Origene. Pure proteins (0.1 μg ...
-
bioRxiv - Cell Biology 2020Quote: ... beta actin (NM_001101) human recombinant protein (Origene, TP720518).
-
bioRxiv - Cell Biology 2020Quote: ... beta actin (NM_001101) human recombinant protein (Origene, TP303643), beta actin (NM_001101 ...
-
bioRxiv - Neuroscience 2021Quote: ... and cDNA encoding human TTL (NP_714923, Origene #RC207805L2) was cloned in it for TTL expression ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human RIOK2-flag cDNAs encoding isoform I (Origene) were cloned into pRev-Tre tetracycline inducible vectors (Clontech) ...
-
bioRxiv - Neuroscience 2020Quote: The cDNA sequence of human GAPDH (OriGene, UK) was inserted into the pET-28b(+ ...
-
bioRxiv - Cancer Biology 2020Quote: ... TFE3 variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cancer Biology 2020Quote: ... human VDR transcript variant 2 cDNA (OriGene, RC519628) was transfected into the SKOV3 cells using Lipofectamine 2000TM (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... whereas the ORF encoding human p130 from Origene.
-
MIIP downregulation promotes colorectal cancer progression via inducing adjacent adipocytes browningbioRxiv - Cancer Biology 2023Quote: ... Human CD36 or control shRNA constructs (Origene, TR314090) were transfected into parental HCT116 cells using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... wells containing 2 µg of human PLG (Origene) were incubated with 3 µg of D-Val-Leu-Lys 4-nitroanilide dihydrochloride chromogenic substrate (S-2251 ...
-
bioRxiv - Cell Biology 2020Quote: ... or FLAG-mNUP153 (mouse) expression vectors were constructed by amplifying full length human NUP153 or mouse NUP153 cDNA using human NUP153 cDNA (Origene, SC116943) or mouse NUP143 cDNA (ATCC ...
-
bioRxiv - Physiology 2023Quote: ... The NAA10-Myc plasmid was constructed by subcloning of a Myc-His tag to replace the Myc-DDK tag in the hNAA10-Myc-DDK plasmid (RC201354, OriGene). The SIK3-Flag plasmid was constructed by subcloning of a 3xFlag tag to replace the Myc-DDK tag in the mSIK3-Myc-DDK plasmid (MR211912 ...
-
bioRxiv - Neuroscience 2023Quote: ... The mouse Synaptophysin gene was cloned as a BamHI/NotI fragment into a modified pCMV6-AN-His vector (Origene, USA) that contains an N-terminal 12xHis tag followed by a PreScission cleavage site ...
-
bioRxiv - Plant Biology 2023Quote: ... overnight at 4°C (anti-PsbA; AS05 084A; anti-PsaB; AS10 695; anti-APC; AS08 277; Agrisera, anti-His tag; TA150087; OriGene). The membrane was washed 3 times in TBST-T at room temperature for 15 minutes each wash followed by incubation with secondary polyclonal anti-rabbit antisera HRP for one hour at room temperature in TBS-T (Jackson ImmunoResearch ...
-
bioRxiv - Neuroscience 2022Quote: Plasmid constructs overexpressing Myc-ddk tagged wild-type human α-syn (Myc-α-synuclein) and Myc-ddk tagged wild-type human UBA52 (Myc-UBA52) were purchased from Origene technologies ...
-
bioRxiv - Microbiology 2021Quote: RNA interference for ATG5 and ATG7 in HepG2 cells was performed according to the protocol of ATG5/7 Human shRNA Plasmid Kits (Origene, Rockville, MD, USA). HepG2 cells (1 × 106 ...
-
bioRxiv - Molecular Biology 2022Quote: ... HC-04 cell line CYP 2D6 RNA levels were compared against commercially available human liver tissue CYP 2D6 RNA levels (OriGene Technologies, Rockville, MD). RNA was reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen ...
-
bioRxiv - Biophysics 2019Quote: ... Human mitofusin 1-GFP was purchased from OriGene (#RG207184).
-
bioRxiv - Molecular Biology 2020Quote: 200 ng of recombinant human Cdt1 (OriGene, Cat #: TP301657) and 20 ng of purified Cyclin A/Cdk1 (Sigma cat ...
-
bioRxiv - Neuroscience 2020Quote: ... human Arcn1 with Myc and Flag tags (RC210778, Origene), Flag-APP-C99 was a kind gift from Wenjie Luo (Weill Cornell Medical College) ...
-
bioRxiv - Neuroscience 2022Quote: A plasmid encoding human TrkB was purchased from OriGene Technologies ...