Labshake search
Citations for Origene Technologies :
51 - 100 of 552 citations for Human KRT12 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... scramble and CAI shRNA lentiviral supernatant were produced by transfection of 293T cells with packaging lentiviral plasmids and either scramble or CAI shRNA lentiviral vectors (Origene, TL510087) followed by concentrating with Lenti-X concentrator (Takara ...
-
bioRxiv - Cancer Biology 2020Quote: ... SLC7A11-shRNA sequence 1 (Origene, Cat. TL309282). Transduced cells were maintained in puromycin and GFP positive cells sorted on a BD FACS Melody cell sorter ...
-
bioRxiv - Cancer Biology 2023Quote: ... or shRNA negative control (Origene, cat.#TR30021) and using the adequate drug for cell selection ...
-
bioRxiv - Cancer Biology 2023Quote: ... or shRNA negative control (OriGene, cat.#TR30033), and using the appropriate drug for cell selection.
-
bioRxiv - Cancer Biology 2023Quote: ... TRF2 shRNA was procured from Origene (TL308880). Side-directed Mutagenesis was performed on the TRF2 WT plasmid to generate the PTM mutants.
-
bioRxiv - Neuroscience 2019Quote: Four shRNAs against Mus musculus Cyp19a1 and one control scrambled shRNA were obtained from Origene (Rockville; Cat No. TG509276). These plasmids express both shRNA under the control of the U6 promoter and turboGFP under the control of a CMV promoter ...
-
Mitochondrial ROS1 increases mitochondrial fission and respiration in oral squamous cancer carcinomabioRxiv - Cancer Biology 2020Quote: The plasmid encoding human ROS1 (ROS1-myc, #RC220652) was obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Cancer Biology 2020Quote: ... Transfected plasmids were human MNT (pCMVSport6-MNT, Origene Technologies, Rockville, MD, USA); ΔbHLH MNT-HA (murine MNT carrying a deletion of amino acids 221-272 amino acids and tagged with HA ...
-
bioRxiv - Neuroscience 2023Quote: The following plasmids have been used in the manuscript: human SATB1 (Origene), human GBA (Origene) ...
-
bioRxiv - Cell Biology 2023Quote: ... A plasmid containing human APOE3-TurboGFP was purchased from Origene (Cat# RG200395). The APOE3 ORF was amplified from APOE3-TurboGFP and subcloned into an mEmerald-N1 backbone via Gibson assembly using HiFi DNA Assembly Master mix (New England Biolabs ...
-
bioRxiv - Developmental Biology 2019Quote: ... Short RNA hairpin (sh-RNA)-based expression vectors for RNA interference pRFP-C-RS (FZD10 shRNAs and scrambled shRNA) were purchased from Origene. The three sequences were ...
-
bioRxiv - Molecular Biology 2023Quote: ... Short hairpin RNA (shRNA) knockdown (KD) cell lines were generated through lentiviral delivery of shRNA pools targeting CBX2 (Origene TL314173), CBX4 (Origene TL314171) ...
-
bioRxiv - Cell Biology 2022Quote: ... The human FLAG-tagged EMC5 plasmid (catalog #: RC207046) and FLAG-tagged EMC6 plasmid (catalog #: RC215548) were obtained from Origene. The mutations EMC3-R31A ...
-
bioRxiv - Cell Biology 2021Quote: Short hairpin RNAs (shRNAs) targeting Acsl4 (TL502838, OriGene) were packaged in the pGFP-C-shLenti plasmid system ...
-
bioRxiv - Cell Biology 2022Quote: ... Axl and scramble shRNAs were purchased from Origene. Recombinant hGas6 and Axl inhibitor R428 were purchased from R&D system ...
-
bioRxiv - Cell Biology 2023Quote: ... scrambled shRNA (TR30012, OriGene Technologies Inc, Rockville, MD) was used instead ...
-
bioRxiv - Cancer Biology 2023Quote: ... The shRNA against PLD2 was provided by Origene.
-
bioRxiv - Cell Biology 2022Quote: ... HESCs were transfected with an empty expression plasmid (control) or human KISS1R expression plasmid corresponding to the open reading frame (Origene) or human ESR1 expression plasmids hESR1-46 or hESR1-66 (Flouriot ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmid encoding human DGKε (hDGKε, NM_003647) was purchased from OriGene (cat. No. RC219913). The DGKE coding sequence was subcloned into the pcDNA3.1/Hygro(+)-2xMyc vector using primers ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: Full-length human dystroglycan cDNA in CMV-6 plasmid was obtained from Origene and used as a template for all of the cloning ...
-
bioRxiv - Cancer Biology 2023Quote: Cells expressing shMdm2 or shScramble were sorted for GFP positive cells and transduced with lentivirus carrying a pool of shRNAs against Sprouty4 (4 different shRNAs purchased from OriGene, cat.#HC108594) or shScramble sequence as control (OriGene ...
-
bioRxiv - Cancer Biology 2023Quote: ... HT1080 p53KO cells were transduced with lentivirus carrying a pool of shRNAs against Mdm2 (4 different shRNAs purchased from OriGene, cat.#TL311529) or shScramble sequence as control (OriGene ...
-
bioRxiv - Genomics 2022Quote: ... sub-confluent human preadipocytes were transfected with 500ng ADGRG6 expression plasmid Myc-DDK-tagged human G protein-coupled receptor 126 (Origene, RC212889) using LipoMag transfection reagent and cells were then subjected to the adipocyte differentiation protocol described above.
-
bioRxiv - Neuroscience 2019Quote: ... and human STAS (NM_015012) were generated by PCR using plasmid templates obtained from OriGene and cloned downstream of the CMV enhancer and chicken beta-actin (CB ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmid DNA with complementary DNA sequences for human mtDNA was obtained from ORIGENE (SC101172). Concentrations were converted to copy number using the formula ...
-
bioRxiv - Cell Biology 2022Quote: ... The human Hsp47 cDNA in pCMV6-XL5 plasmid was obtained from Origene (catalog#: SC119367). Scrambled siRNA GFP lentivector (catalog # ...
-
bioRxiv - Biochemistry 2023Quote: ... The wild-type human genes mS25 and bS16m were obtained in plasmids from OriGene. Mutations of cysteine/s in bS16m and mS25 coordinating Fe-S clusters to alanine ...
-
bioRxiv - Cell Biology 2019Quote: ... OVCA429 cells were transfected with GFP-mDia2 shRNA constructs (Origene) using Fugene (Promega (Madison ...
-
bioRxiv - Cell Biology 2019Quote: ... and mDia2 shRNA and control pGFPVRS from Origene (Rockville, MD) respectively.
-
bioRxiv - Neuroscience 2023Quote: ... or vector encoding non-targeting shRNA (shControl; TR30021, OriGene Technologies) were packed in LV by cotransfection with psPAX2 (gift from Didier Trono ...
-
bioRxiv - Cancer Biology 2023Quote: ... siCOP1 and shRNAs against Cul9 and ATG5 were from Origene, shCOP1 was from Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2020Quote: ... Recombinant human Lsm12-expression plasmids were obtained either commercially (pCMV-Lsm12-Myc-FLAG from OriGene) or were constructed with pcDNA6 (pCDNA6-Lsm12-FLAG-His) ...
-
bioRxiv - Biochemistry 2021Quote: All shRNA constructs for MICS1 and LETM1 were obtained from Origene Technologies (Rockville ...
-
bioRxiv - Neuroscience 2021Quote: ... were applied and scrambled shRNA was used as control (OriGene, #TR30021). For overexpression experiments ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid containing human Sirt3102-399 (pEX-His-hSIRT3102-399) was purchased from OriGene (Rockville, MD).
-
bioRxiv - Cell Biology 2021Quote: Cells were transiently transfected with a human KLK10-encoding plasmid (pCMV6-KLK10-Myc-DDK; Origene RC201139) at 0.1-1 μg/mL or as a control a GFP plasmid (PmaxGFP ...
-
bioRxiv - Cancer Biology 2020Quote: PGC1α (encoded by PPARGC1A) was knocked-down with shRNA constructs (TG310260, Origene) in LNCaP cells (LNCaP_shPGC1A ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were infected with lentiviral carrying shRNA specific to DCP1a (OriGene) or DCP1b (OriGene ...
-
bioRxiv - Cancer Biology 2021Quote: ... THEM6 human tagged ORF clone overexpressing plasmid and respective control (RC201709 and PS100001, Origene, Rockville, MD, USA) were purchased from Origene ...
-
bioRxiv - Bioengineering 2020Quote: ... to transfect GFP-tagged human tumor necrosis factor receptor superfamily 10b (GFP-TNFRSF10B/GFP-DR5) plasmid (OriGene) into the cell lines ...
-
bioRxiv - Biochemistry 2020Quote: ... The plasmid containing human Sirt3,102-399 (pEX-His-hSIRT3,102-399) was purchased from OriGene (Rockville, molecular dynamics).
-
bioRxiv - Neuroscience 2022Quote: ... Myc-DDK tagged wild type human α-synuclein (Myc-α-SYN) plasmid constructs were purchased from OriGene technologies ...
-
bioRxiv - Genetics 2023Quote: The plasmid encoding wild-type human COL2A1 (variant IIB, consensus sequence) was obtained from Origene (#RG221644, NM_033150). The C-terminal GFP tag was removed and replaced by a stop codon ...
-
bioRxiv - Cancer Biology 2019Quote: ... shWRNIP1 cell line was generated by stably expressing shRNA against WRNIP1 (shWRNIP1) (OriGene). Cells were cultured in the presence of puromycin (100 ng/ml ...
-
bioRxiv - Genomics 2019Quote: ... pGFP-C-shRNA-Lenti-B2M and pGFP-C-scrambled were purchased from Origene. The packaging vectors PmD2G and PsPAX.2 were obtained from Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ShRNA for canine synaptopodin cloned into puromycin-selectable pRS mammalian expression vector (Origene) has previously been described (Kannan and Tang ...
-
bioRxiv - Cell Biology 2019Quote: We used a short hairpin RNA (shRNA, 29-mer; OriGene Technologies, Rockville, MD) expression vector that effectively down-regulates TMEM163 expression as we previously reported (Eichelsdoerfer et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... and MK5 specific shRNA construct in lentiviral GFP vector were purchased from Origene (Rockville ...
-
bioRxiv - Immunology 2022Quote: ... HC108542B–AGTTGTGTTGTCCAGTTTCCTGTCCATGC and scrambled negative control non-effective shRNA (Origene Item no: TR30023). Lentivirus was packaged by co-transfecting shRNA and psPAX2 and pVSVG packaging plasmids into HEK293T cells ...
-
bioRxiv - Microbiology 2019Quote: ... The lentiviral expression plasmid pLenti-C-Myc-DDK harboring the human vimentin gene (NM_003380, pLenti-VIM) was obtained from Origene. To generate lentiviruses ...