Labshake search
Citations for Origene Technologies :
51 - 100 of 294 citations for Anti P2Y12 Platelet ADP Receptor antibody produced in rabbit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2020Quote: ... rabbit anti-EMX1 (Origene, TA325087, WB 1:1000 in BSA), rabbit anti-BLBP (Abcam ...
-
bioRxiv - Physiology 2023Quote: ... Rabbit polyclonal anti-human C12orf23 (TMEM263) was from Origene (TA333490). Mouse monoclonal JAK2 (C-10) ...
-
bioRxiv - Neuroscience 2022Quote: ... and b) rabbit polyclonal anti-GLP-1R (1:50; Origene) and mouse monoclonal anti-GFAP antibody (1:500 ...
-
bioRxiv - Immunology 2020Quote: ... cDNA clones in pCMV6 plasmid for these chemokine receptors were obtained from Origene (Rockville, MD). 2 million L1.2 cells were transfected with 2 µg of plasmid using the SG Cell Line transfection kit and a 4D-Nucleofector X (both from Lonza ...
-
bioRxiv - Cell Biology 2020Quote: ... We used the following primary antibodies: α-PRX3 (TA322472, rabbit; Origene, Rockville, USA), α-Mitofilin (ab48139 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 0.012 μg of bacterially produced and purified recombinant IMP3 protein (Origene, cat#TP760798) in hypotonic lysis buffer (5 mM Tris ...
-
bioRxiv - Cancer Biology 2021Quote: ... the anti-MYC antibody 9E10 was from Origene, the anti-Strep-tag antibody from Biorad ...
-
bioRxiv - Microbiology 2024Quote: ... and anti-CD3 antibody at 1:150 (OriGene) tagged to AlexaFluor 647 antibodies were used for immunostaining of slides ...
-
bioRxiv - Immunology 2024Quote: ... and HRP-labeled rabbit secondary antibody (cat. no. ZB-2301) was provided by OriGene Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... HTSF1–mNeonGreen was produced by cloning the HTATSF1 from pCMV6-Entry (Origene, Rockville, MD, USA) vector into the pEYFP-N1 vector between AfeI/SalI restriction sites ...
-
bioRxiv - Neuroscience 2022Quote: ... and anti-HCRTR1 from rabbit (Origene Cat#TA328918; 1:100–1:500). Donkey IgG secondary antibodies coupled to Alexa-594 ...
-
bioRxiv - Biochemistry 2022Quote: ... and the other with anti-METTL7A primary antibody (Origene, Rockville MD ...
-
bioRxiv - Bioengineering 2020Quote: ... to transfect GFP-tagged human tumor necrosis factor receptor superfamily 10b (GFP-TNFRSF10B/GFP-DR5) plasmid (OriGene) into the cell lines ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-GAPDH (2D9) and a rabbitt polyclonal anti-CEACAM1 (TA350817) antibody were from Origene. Anti-Rabbit-HRP and anti-mouse-HRP were from Cell Signalling Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-GAPDH antibody (TA802519) is from Origene (WB-1:5000), anti-HA antibody (C29F4 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 1 µg/ml of biotinylated anti-huEL monoclonal antibody (OriGene) was added at 35 µl/well and incubated for additional 60 minutes ± 10 minutes at RT on a plate shaker ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies: goat anti-mCherry (1:1000) (Origene AB0040-200), chicken anti-GFP (1:500 ...
-
bioRxiv - Immunology 2022Quote: ... stable cell lines were produced using commercially designed lentivirus particles targeting mouse Gsdmc2 (NM_001168274.1) and Gsdmc3 (NM_183194.3) (Origene #HC108542): shRNA HC1008542A– AGTATTCAATACCTATCCCAAAGGGTTCG ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the membrane was incubated overnight at 4°C with primary antibody solution (1:1000 dilution for anti-TSG101 [Abcam, ab30871], anti-Calnexin [ThermoFisher, PA5-19169] and anti-Syntenin-1 [Origene, TA504796] ...
-
bioRxiv - Microbiology 2024Quote: ... Antibodies of anti-HA and anti-Flag for immunoprecipitation were bought from Origene (cat no. TA100012) and Sigma-Aldrich (cat no ...
-
bioRxiv - Cell Biology 2020Quote: ... then fixed with 4% PFA and stained with 1:5000 rabbit anti-EGFP (Origene) and anti-rabbit AF647 (10μg/ml ...
-
bioRxiv - Molecular Biology 2022Quote: Sandwich ELISA was performed with mouse anti-NDV-HN antibodies (OriGene) diluted 1:100 in PBS for 1 h to capture whole attenuated NDV (VH ...
-
bioRxiv - Immunology 2024Quote: ... AMPKɣ was immunoprecipitated with Anti-His tag monoclonal antibody (TA100013, OriGene) after 5 minutes of in vitro reaction at 30 °C ...
-
bioRxiv - Pathology 2024Quote: ... and anti-CD44 mouse monoclonal antibody (UMAB134, OriGene Technologies, Rockville, MD) were used as primary antibodies ...
-
bioRxiv - Cell Biology 2024Quote: ... Anti-DDK mouse monoclonal antibodies (CAT#: TA150014) were purchased from Origene.
-
bioRxiv - Cell Biology 2024Quote: The generation of human cMPL receptor-expressing HEK293-A cells was achieved through a lipofectamine-mediated transfection of a plasmid expressing cMPL and GFP (Origene), previously linearized using the Scal restriction enzyme (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... and polyclonal anti-rabbit IgG-HRP raised in goat (R1364HRP, 1:5,000; OriGene, Herford, Germany)
-
bioRxiv - Cancer Biology 2020Quote: In vitro immunoprecipitations were prepared using 0.012 μg of bacterially produced and purified recombinant RIOK2 protein (Origene, cat#TP602270) and 0.012 μg of bacterially produced and purified recombinant IMP3 protein (Origene ...
-
bioRxiv - Genetics 2020Quote: ... cells were fixed and stained with an anti-DDK antibody (OriGene, TA50011), and actin and dapi probes as described for immunofluorescence above ...
-
bioRxiv - Neuroscience 2023Quote: ... was then used with an anti-FKBP5 antibody (OriGene, Rockville, MD, USA) at a 1 in 80 dilution ...
-
bioRxiv - Neuroscience 2024Quote: ... or a dilution of 1/1,000 anti-turboGFP chicken antibody (Origene; TA150075) respectively ...
-
bioRxiv - Cell Biology 2023Quote: ... two different anti-human DSG2 antibodies (DSG2-Origene, #BM5016; DSG2-Abcam, #ab14415) were used at 1:1000 dilutions in blocking buffer ...
-
bioRxiv - Genomics 2022Quote: ... sub-confluent human preadipocytes were transfected with 500ng ADGRG6 expression plasmid Myc-DDK-tagged human G protein-coupled receptor 126 (Origene, RC212889) using LipoMag transfection reagent and cells were then subjected to the adipocyte differentiation protocol described above.
-
bioRxiv - Cell Biology 2020Quote: ... a gBlock containing the coding sequence for LaNt α31-PAmCherry with EcoR1 and NheI restriction enzyme compatible overhangs (synthesised by Integrated DNA Technologies) was inserted into the pLenti-puromycin vector and packaged in lentiviral particles (produced by Origene). (PS100109 ...
-
bioRxiv - Cell Biology 2023Quote: A recombinant hCABS1 overexpression lysate (OEL) produced in Human Embryonic Kidney 293T (HEK293T) cells (OriGene Technologies Inc., Rockville, MD, USA) was used as a positive control in WB ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293/GC-A+/AT1+ and HEK293/GC-A+/AT2+ cell lines were generated from HEK293/GC-A+ transfected with lentiviral particle with clones of either human AT1 or AT2 receptor (OriGene, Rockville, MD) using polybrene transfection agent ...
-
bioRxiv - Biophysics 2021Quote: ... mouse anti-human PD-L1 (primary antibody, CD273, Clone OTI9E12, ORIGENE, MD, USA) and APC goat anti-mouse IgG (secondary antibody ...
-
bioRxiv - Cell Biology 2021Quote: ... The following primary antibodies were used: anti-mCherry (AB0040-200, Origene, 1:500), anti-myc 9E10 (13-2500 ...
-
bioRxiv - Neuroscience 2021Quote: ... and guinea pig anti-Drebrin polyclonal antibody (1:100, OriGene Technologies, Herford, Germany). Neural dendrites were detected with the neurofilament marker anti-SMI 311 mouse monoclonal antibody (1:600 ...
-
bioRxiv - Neuroscience 2023Quote: ... and then incubated with goat anti-tdTomato antibody (1:300, Origene, # AB8181-200), rabbit anti-St8sia1 (GD3S ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary monoclonal antibodies included mouse anti-human ACE2 (1:1500) (Origene, Rockland, Maryland), rabbit anti-human (1:1000 ...
-
bioRxiv - Biochemistry 2024Quote: ... anti-PLIN2 antibody was diluted 1:1000 in 5% BSA in TBST (Origene). Secondaries Goat Anti-Rabbit IgG StarBright Blue 700 (Bio-Rad Laboratories ...
-
bioRxiv - Synthetic Biology 2024Quote: ... for 1 h at room temperature and incubated with primary antibodies (1:1000 dilution for anti-Calnexin [ThermoFisher, PA5-19169], anti-Syntenin-1 [Origene, TA504796] ...
-
bioRxiv - Developmental Biology 2022Quote: ... the slides were incubated with goat anti-rabbit IgG conjugated to horseradish peroxidase (HRP) (ORIGENE, ZB-2301) at RT for 1 h ...
-
bioRxiv - Neuroscience 2022Quote: ... were double immunostained using the following antisera couples: a) rabbit polyclonal anti-GLP-1R (1:50; Origene) and mouse monoclonal anti-NUCB2/nesfatin-1 antibody (1:50 ...
-
bioRxiv - Immunology 2021Quote: ... scramble and CAI shRNA lentiviral supernatant were produced by transfection of 293T cells with packaging lentiviral plasmids and either scramble or CAI shRNA lentiviral vectors (Origene, TL510087) followed by concentrating with Lenti-X concentrator (Takara ...
-
bioRxiv - Synthetic Biology 2022Quote: ... measuring association by dipping tips in undiluted PTH produced in CFPS and purified as previously described or in 67 μg/ml of a commercially produced positive control PTH (OriGene SA6052) for 180 s ...
-
bioRxiv - Microbiology 2020Quote: ... FLAG-tagged MtTop1 was detected with anti-DDK (FLAG) antibodies (Origene, TA50011, 1:2,500). Membranes were incubated with primary antibodies at room temperature for 3 hr ...
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibodies were used: goat anti-mCherry (Origene, AB0040-200, 1:500), mouse anti-His (Dianova ...
-
bioRxiv - Immunology 2022Quote: Lung section slides were also stained with 1 µg/mL rabbit polyclonal anti-NEU1 (TA335236; Origene, Rockville, MD), anti-NEU2 (TA324482 ...