Labshake search
Citations for Origene Technologies :
51 - 100 of 151 citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... alpha 2 (IFNA2) (OriGene Technologies Inc, Atlanta, GA) (100 ng/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... TFE3 variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cancer Biology 2020Quote: ... human VDR transcript variant 2 cDNA (OriGene, RC519628) was transfected into the SKOV3 cells using Lipofectamine 2000TM (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... wells containing 2 µg of human PLG (Origene) were incubated with 3 µg of D-Val-Leu-Lys 4-nitroanilide dihydrochloride chromogenic substrate (S-2251 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mutant PES1 (#CW306514) and POLR2K (#CW306515) 3’UTR clones were all purchased from Origene. Mutant 3’UTR plasmids were generated by synthesizing 3’ UTR sequences in which the three GCCCCC seed matches in the 3’ UTR of PES1 and one in 3’ UTR of POLR2K was each changed to TGCAAA and this altered sequence was each inserted into the pmiRTarget construct by Origene ...
-
bioRxiv - Cancer Biology 2021Quote: ... with 3 @g of either pCMV-6-Entry vector (OriGene, cat# PS100001, Rockville, MD) or pCMV-6-Entry expressing the CKB TrueORF (cat#RC203669) ...
-
bioRxiv - Biochemistry 2023Quote: ... About 5 x 106 HEK-293T cells were transfected with 5 µg of the plasmid pCMV6-XL5 HSD2 (SC122552, OriGene Technologies, Inc., Rockville, MD, USA) using the Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-desmoglein-2 mouse monoclonal (Origene, Rockville, MD, USA), anti-E-cadherin mouse monoclonal (BD ...
-
bioRxiv - Neuroscience 2020Quote: ... and mitofusin 2 (Mfn) was obtained from OriGene (SC114726). To generate MG constructs ...
-
bioRxiv - Neuroscience 2021Quote: ... hippocampal neurons were treated at DIV 3 with AAV1mCherry-pU6-Kv2.1 shRNA designed by OriGene (target sequence ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 μl Lipofectamine 2000 was mixed with 1 μg of each HA-ZNF804A (Origene, RG211363) or Myc-NT5C2 (Origene ...
-
bioRxiv - Developmental Biology 2023Quote: ... Antibodies used are as follows: for immunoprecipitation (OriGene, CAT #TA-50011-3 and Origene, #TA150041); for western blot ...
-
bioRxiv - Molecular Biology 2019Quote: ... Plasmids were transfected into HAP1 cells seeded on a 6-well plate with Turbofectin (OriGene) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... anti-SARS-CoV-2 Spike Protein was purchased from Origene Technologies Inc ...
-
bioRxiv - Zoology 2023Quote: ... an empty vector or human MD-2 (OriGene, cat. #RC204686) were transiently expressed ...
-
bioRxiv - Microbiology 2020Quote: CD4+ 293T cells were transfected with 25 pmol of pooled siRNA (Origene, 3 siRNA per pool) with RNAiMax twice (on day 1 and 3) ...
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 CIC OE cells were developed using CIC-Myc-tag plasmid purchased from Origene (CAT#: RC215209). Geneticin (250μg/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-cleaved Caspase-3 (9661S, CST, 1:500) and anti-Flag (TA-50011-100; Origene, 1:500). Cells were washed with PBS and incubated with secondary antibodies (Jackson Immunoresearch Laboratories ...
-
bioRxiv - Immunology 2023Quote: The plasmid expressing myc-DDK-tagged wild-type ADA2 (transcript variant 3, NM_001282225) was purchased from OriGene Technologies (#RC238645) ...
-
bioRxiv - Genomics 2019Quote: ... For the 5’ eQTL a 250 bp construct containing the rs17168486 SNP (Origene) was subcloned into the Firefly luciferase reporter vector pGL4.23 (Promega ...
-
bioRxiv - Cancer Biology 2021Quote: ... Increasing concentrations (0, 2.5, 5 and 10 nM) of scrambled (scr, OriGene, SR30004) or ABCE1 siRNAs diluted in OptiMEM (Thermofisher ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293T cells were seeded at a density of 1.4x105 cells per well in 6-well plates and transfected with 0.5-2.5ug of LRRC37A plasmid (Origene) or empty vector control (Origene ...
-
bioRxiv - Genomics 2019Quote: ... The next day each plate of cells was transfected with a mixture of both gRNA plasmids and both allele amplicons in a 0.45:0.45:0.05:0.05 ratio with a total of 18 ug of DNA per plate using Turbofectin 8.0 (Origene) and otherwise following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 3×106 HEK293T cells were transfected with pLKO_1 (encoding sh_RNAi) or pCMV6-AC (Origene #RG217766, encoding GFP-UHRF1) lentiviral plasmids ...
-
bioRxiv - Microbiology 2024Quote: ... The cleared medium was supplemented with 1:5 Lenti Concentrator (OriGene, Rockville, MD, USA) and incubated 2-4 hours at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... and C and Nuak kinases 1 and 2 were purchased from OriGene Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... which were prepared using 10 pmol/well (of 6 well cell culture plate) Acot2 or control siRNA (Origene) and 1.5ul of Lipofectamine RNAiMAX using forward transfection ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T-NF-κB cells were seeded in 24-well plate and were transfected the following day with siRNAs using the siTran 1.0 transfection reagent (Origene). The next day ...
-
bioRxiv - Molecular Biology 2021Quote: ... About 160,000 HAP1 cells per well were plated in 6-well plate and on the next day transfected using TurboFectin 8.0 (OriGene) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... 293T cells were co-trasfected with 1μg per well of 6-well plate of either pCAGGS/GST or pCAGGS/GSTVPS28 and with with 1μg per well of 6-well plate of pCMV6-Entry-AKTIP-Myc-Flag (ORIGENE) or with 1μg per well of 6-well plate of AKTIP-HA (pCR3.1 ...
-
bioRxiv - Biochemistry 2022Quote: ... HEK293-Klotho cells were seeded at density of 500 000 cells/well on 6-well tissue culture plates and transfected with RhoGDI1 (ARHGDIA) (NM_004309) Human Tagged ORF Clone (RG200902 OriGene) using Lipofectamine 3000 Transfection Reagent (L3000015 Invitrogen ...
-
bioRxiv - Physiology 2022Quote: ... coated 6-well plates (SPL Life Sciences Co., Korea) with Kcnq4 Mouse Tagged ORF Clone (OriGene, Rockville, MD, USA) using Lipofectamine LTX and Plus Reagents (Invitrogen ...
-
bioRxiv - Physiology 2019Quote: ... NRVMs (1 – 3 days post isolation) were transiently transfected with either variant 8 of human BIN1 (AmpII) (Origene Inc, USA) cloned into pCMV6-AC-mKate2 entry vector (Origene Inc ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a human GAB1 3′-UTR reporter plasmid (containing 3770 bp immediately downstream of the end of the GAB1 ORF cloned into pMirTarget, Origene), a control Renilla luciferase plasmid (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... wells were blocked with 1% BSA diluted in PBS for 30 min at 37 °C and increasing amounts (0 μg to 3 μg) of PLG (Origene) diluted in blocking solution were added to the wells and incubated for 1 hour at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: The BAP1 RNA knockdown was performed with a set of 3 unique 27-mer siRNA duplexes targeting BAP1 (Origene, SR305435) using siTrans 1.0 (Origene) ...
-
bioRxiv - Cell Biology 2024Quote: ... A commercial Cotinine ELISA kit (Origene) suitable for mice was used to quantify blood levels ...
-
bioRxiv - Developmental Biology 2021Quote: ... cells were transduced (MOI=2) with a lentivirus constitutively expressing GFP (OriGene Tech # PS100093V). A pure GFP population was generated with puromycin selection for a few days in culture before use in experiments and cell line storage.
-
bioRxiv - Microbiology 2021Quote: Full length human ACE-2-MycDDK in pCMV-6 entry vector (Origene, cat #RC208442) was expressed in Expi293™ cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... China) and Native ORF cIAP-2 clone in pCMV vector was purchased from Origene, Rockville ...
-
bioRxiv - Cancer Biology 2019Quote: ... KDELR3 transcript variant 2 (NM_016657) Human Myc-DDK-tagged ORF Clone (Origene, CAT#: RC216726), KDELR3 transcript variant 1 (NM_006855 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were transfected in 12-well plates via reverse transfection where purified empty or FLAG-tagged METTL7B overexpression plasmids (Origene) were mixed with P3000 reagent in OptiMEM at room temperature followed by Lipofectamine 3000 ...
-
bioRxiv - Cell Biology 2022Quote: ... For protein-protein interaction experiments using the pCMV6 vector with HA or Myc-DDK peptide tag at the 3’-end (Origene Technologies), we used the same IF cloning system to subclone cDNAs of our genes-of-interests (GOIs ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μg of pLenti-Envelop vector and 6 μg of packaging plasmids (OriGene Technologies, Inc. Rockville, MD) to isolate lentivirus according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... [TL51074CB 5’ –AGACCGTAAACGCTATCAGCAAGAAGTAG] are in the plasmid backbone pGFP-C-shLenti and were from Origene (Rockville, MD). The non-targeting shRNA control ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μm-thick paraffin sections were deparaffinized and stained with anti-human KI67 (1:500, TA802544, Origene), anti-mouse Ki67 (1:800 ...
-
bioRxiv - Cancer Biology 2020Quote: ... A primary mouse monoclonal Lysyl Hydroxylase 2 (LH2) antibody (Origene; Cat# TA803224, dilution 1:150) was used for the immunohistochemical staining.
-
bioRxiv - Microbiology 2024Quote: ... seed in a 6-well plate were transiently co-transfected with 200 ng of a myc-tagged FOS (pCMV6-FOS, OriGene, RC202597) and 600 ng of a wt ORF57 (pVM7 ...
-
bioRxiv - Cell Biology 2019Quote: ... 5% heat-inactivated goat serum) and incubated with primary antibody (1:1000 anti-DDK monoclonal 4C5; OriGene Technologies) in PBT1 at 4°C overnight ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HEK293-Null2 cells were also co-transfected with a human MD-2 expression clone (OriGene, RC204686). JetPRIME (Polyplus ...