Labshake search
Citations for Origene Technologies :
501 - 550 of 639 citations for Recombinant Mouse Programmed Cell Death 1 Ligand 2 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... cells were fixed and stained with an anti-DDK antibody (OriGene, TA50011), and actin and dapi probes as described for immunofluorescence above ...
-
bioRxiv - Cell Biology 2020Quote: ... the gene for NPM was amplified from cDNA library (Jurkat cells, Origene) by PCR and inserted to vectors peGFP-C2 and pmRFP1-C2 (originally Clontech) ...
-
bioRxiv - Molecular Biology 2021Quote: ... YTHDC1 mRNA knockdown in 293T cells was performed using siRNAs (Origene # SR314128) transfected using Lipofectamine RNAiMax (Invitrogen).
-
bioRxiv - Immunology 2020Quote: ... HEK293T cells were individually transfected with plasmids encoding for secreted proteins (OriGene Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plasmids for overexpression in HEK293T cells were purchased from OriGene (Rockville, MD): pCMV6 (PS10001) ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were infected with lentiviral carrying shRNA specific to DCP1a (OriGene) or DCP1b (OriGene ...
-
bioRxiv - Immunology 2021Quote: NLRP1 and CARD8 transcript variant 1 DNA obtained commercially from Origene (pCMV6-entry clones RC216481 and RC230245 ...
-
bioRxiv - Genetics 2023Quote: ... SMCs were stained with anti-ZC3HC1 (Origene, AP20366PU-N, 1:100), anti-Tubulin (abcam ...
-
bioRxiv - Cancer Biology 2020Quote: ... a specified amount of plasmid was transfected into cells using Turbofectin 8.0 (Origene) by following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2019Quote: ... shWRNIP1 cell line was generated by stably expressing shRNA against WRNIP1 (shWRNIP1) (OriGene). Cells were cultured in the presence of puromycin (100 ng/ml ...
-
bioRxiv - Biochemistry 2021Quote: U2OS-WT cells were plated and transfected with the pCas9-Guide (Origene GE100002) constructs using Lipofectamine 2000 overnight ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells transduced with the empty pLenti-C-mGFP-P2A-Puro vector (PS100093, OriGene), (HT29GFP and Caco2GFP ...
-
bioRxiv - Pathology 2022Quote: HEK293 cells were transiently transfected with overexpressing plasmids for IL-31RA (Origene, RC218212L1) and CHRM3 (Origene ...
-
bioRxiv - Immunology 2022Quote: ... cells were transduced with pLenti BCL6 ORF-mGFP or empty mGFP only (Origene).
-
bioRxiv - Immunology 2022Quote: ... HEK293 cells were transduced using the LentiORF® clone of CIITA (OriGene RC222253L3). The cells were selected using puromycin selection marker for 2 passages over the period of 7 days ...
-
bioRxiv - Biochemistry 2023Quote: ... or 10 μg human ACSS2-overexpressing HEK-293 cell lysate (ref. LY412981, Origene, MD ...
-
bioRxiv - Immunology 2022Quote: ... 1 μl from a 200 ng/μl stock of NEU1 (TP300386; Origene), NEU2 (TP319858 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The primary antibodies used were: rabbit anti-GFP (1:500; Origene TP401), mouse anti-GFP (1:500 ...
-
bioRxiv - Developmental Biology 2019Quote: ... The primary antibody anti-DDK (FLAG®) (OriGene Technologies, TA50011, 1:1000) was used for detection of proteins overexpressed from the pCMV6-entry vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... The following primary antibodies were incubated overnight: TRIM24 (1:200, TA802797, Origene), TRIM33 (1:200 ...
-
bioRxiv - Immunology 2022Quote: ... Human MR1 transcript variant 1 (NM_001531) cDNA clone was purchased from Origene. The constructs were then cloned into a lentiviral expression vector with a multiple cloning site separated from GFP reporter via an Internal Ribosomal Entry Site (IRES).
-
bioRxiv - Immunology 2023Quote: ... anti-DDK (FLAG) (clone OTI4C5, #TA50011, 1:1000; OriGene Technologies; RRID: AB_2622345), anti-LC3B (#ab51520 ...
-
bioRxiv - Neuroscience 2024Quote: ... or a dilution of 1/1,000 anti-turboGFP chicken antibody (Origene; TA150075) respectively ...
-
bioRxiv - Bioengineering 2024Quote: ... Primary antibodies pan cytokeratin (PanCK, 1:100, OriGene Catalog # CF190032, Lot # F003) and vimentin (VIM ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were transfected with siRNA using siTran 1.0 transfection reagent (Origene, Rockville, MD; TT300003) DMEM/2.5% FBE growth medium for 4 days ...
-
bioRxiv - Biochemistry 2021Quote: ... MICS1KD cells were generated using the human shRNA plasmid kit for MICS1 (Origene, TR315671B) with the shRNA construct #1 (GGTCTTGGAGCATTCTGCTACTATGGCTT ...
-
bioRxiv - Cell Biology 2019Quote: HT1080 cells were transfected with ER-SFGFP-iE using MegaTran 1.0 (OriGene, Cambridge, UK) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... The U2-OS and HEK-293 cells transfected with empty pCMV6 (PS10001, Origene, MD) and pCMV6/CA-IX vectors (CQ10630 ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were transfected with 5ug of FOLR3 expression plasmid with FLAG tag (Origene RC212963) using JetPRIME transfection reagent (Polyplus ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were transduced with a set of 4 shRNAs against Spry4 (OriGene, cat.#HC108594) or shRNA negative control (OriGene ...
-
bioRxiv - Cancer Biology 2024Quote: ... CRISPR-KO VPAC2KO Panc02 cells were similarly transduced with VPAC2-overexpression lentiviral particles (Origene) at 50 MOI for the rescue experiment ...
-
bioRxiv - Biophysics 2024Quote: ... HEK293T cells were transfected with rat CaMKIIα WT (pCMV6-CaMKIIα-Myc-DDK, #RR201121, Origene), which was generated and sequence-verified by GenScript Biotech (Leiden ...
-
bioRxiv - Biochemistry 2021Quote: ... Plasmids containing human TIM-1 and human TIM-4 were obtained from Origene. For expression of extracellular regions ...
-
bioRxiv - Cell Biology 2019Quote: The following primary antibodies were used: Goat anti-GFP (Origene; R1091P; 1:200), rabbit polyclonal anti-keratin 5 (BioLegend ...
-
bioRxiv - Cell Biology 2021Quote: ... The following primary antibodies were used: anti-mCherry (AB0040-200, Origene, 1:500), anti-myc 9E10 (13-2500 ...
-
bioRxiv - Neuroscience 2021Quote: ... and guinea pig anti-Drebrin polyclonal antibody (1:100, OriGene Technologies, Herford, Germany). Neural dendrites were detected with the neurofilament marker anti-SMI 311 mouse monoclonal antibody (1:600 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and stained with 1:2000 HRP-conjugated anti-human ACE2 (clone OTI1D2, Origene) or 1:5000 HRP-conjugated donkey anti-human IgG (Jackson Immuno Research ...
-
bioRxiv - Neuroscience 2023Quote: ... and then incubated with goat anti-tdTomato antibody (1:300, Origene, # AB8181-200), rabbit anti-St8sia1 (GD3S ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibodies used: YFP Goat polyclonal antibody (1:500) (ORIGENE, Cat.No. AB1166-100), mouse mCherry antibody (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... Coverslips were then incubated overnight at 4 °C with EWS (Origene, 1:200) and pH2AX (CST ...
-
bioRxiv - Biophysics 2022Quote: Transfection of cells was performed transiently with plasmid DNA using Turbofectin 8.0 (PN: TF81001, Origene), according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... On DAY4 OTII cells were transduced with C1qbp lentiviral particles (Lenti ORF, C1qbp, Origene, NM_007573) versus Lenti-ORF Control Particles at a multiplicity of infection (MOI ...
-
bioRxiv - Molecular Biology 2019Quote: ... Plasmids were transfected into HAP1 cells seeded on a 6-well plate with Turbofectin (OriGene) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... PNT1A-HIP1 cells transfected with plasmid expressing scrambled hairpin RNA (Origene, HuSH pRS plasmids #TR312457) supplied within the same kit ...
-
bioRxiv - Cell Biology 2020Quote: HEK293 cells were stably transfected with either empty vector (pCMV6) or Sox9 expression vector (Origene). These cells were then utilized for promoter luciferase reporter assays using methods reported in our recent studies (31,61) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HEK293 cells were stably transfected with HA-MOP and GFP-conjugated GIRK2 channel plasmids (OriGene). The cells were then seeded in 96-well plates and allowed to grow at 37°C in 5% CO2 for 48 h ...
-
bioRxiv - Genetics 2023Quote: SCN1A splicing reporter plasmids (5ug) were transfected in HEK293T cells using TurboFectin 8.0 (Origene #TF81001). After twenty-four hours ...
-
bioRxiv - Cell Biology 2023Quote: Transfection of cells was performed transiently with plasmid DNA using Turbofectin 8.0 (PN: TF81001, Origene), according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... HEK293T and K7M2 cells were transduced with a pLenti-LRRC15-GFP-Puro vector (Origene, NM_130830) with a multiplicity of infection of 5 ...
-
Pluripotent stem cell SOX9 and INS reporters facilitate differentiation into insulin-producing cellsbioRxiv - Developmental Biology 2021Quote: ... The membrane was incubated with anti-CPA1 (1:1000, Origene, cat# TA500053, clone OTI2A3) overnight at 4°C then washed and followed by incubation with the peroxidase-labeled secondary antibody for 1 h ...