Labshake search
Citations for Origene Technologies :
451 - 500 of 511 citations for Human Immunodeficiency Virus p24 Protein HIV 1 Clade B since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... and guinea pig anti-Drebrin polyclonal antibody (1:100, OriGene Technologies, Herford, Germany). Neural dendrites were detected with the neurofilament marker anti-SMI 311 mouse monoclonal antibody (1:600 ...
-
bioRxiv - Neuroscience 2023Quote: ... and then incubated with goat anti-tdTomato antibody (1:300, Origene, # AB8181-200), rabbit anti-St8sia1 (GD3S ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibodies used: YFP Goat polyclonal antibody (1:500) (ORIGENE, Cat.No. AB1166-100), mouse mCherry antibody (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... and anti-LGR5 mouse monoclonal conjugated with PE at 1:100 (Origene #TA400001). Apart from the LGR5 antibody incubation (of 20 minutes) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Coverslips were then incubated overnight at 4 °C with EWS (Origene, 1:200) and pH2AX (CST ...
-
Pluripotent stem cell SOX9 and INS reporters facilitate differentiation into insulin-producing cellsbioRxiv - Developmental Biology 2021Quote: ... The membrane was incubated with anti-CPA1 (1:1000, Origene, cat# TA500053, clone OTI2A3) overnight at 4°C then washed and followed by incubation with the peroxidase-labeled secondary antibody for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... FLAG-tagged MtTop1 was detected with anti-DDK (FLAG) antibodies (Origene, TA50011, 1:2,500). Membranes were incubated with primary antibodies at room temperature for 3 hr ...
-
bioRxiv - Cell Biology 2021Quote: ... Antibodies or reagents used were: (i) CD235a-PE (1:2500 dilution; OriGene cat#DM066R), CD49d-BV421 (1:100 dilution ...
-
bioRxiv - Bioengineering 2022Quote: ... Antibodies or reagents used were: (i) CD235a-PE (1:2500 dilution; OriGene cat#DM066R), CD49d-BV421 (1:100 dilution ...
-
bioRxiv - Cell Biology 2020Quote: ... then fixed with 4% PFA and stained with 1:5000 rabbit anti-EGFP (Origene) and anti-rabbit AF647 (10μg/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1×104 cells were mixed with mock or Igfbp2 lentivirus (catalog # MR204287L3V; OriGene Technologies) at MOI=80 in the 500 ml of 10 µg/ml polybrene/DMEM-F12 ...
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibodies were used: goat anti-mCherry (Origene, AB0040-200, 1:500), mouse anti-His (Dianova ...
-
bioRxiv - Genomics 2024Quote: ... a plasmid containing the sequences for NY-ESO-1 (CTAG1B) was ordered from OriGene Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... The cleared medium was supplemented with 1:5 Lenti Concentrator (OriGene, Rockville, MD, USA) and incubated 2-4 hours at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse monoclonal antibody directed against α1-actinin (#TA500072S, IF dilution 1:100) was from Origene. Phalloidin-Alexa488 ...
-
bioRxiv - Genomics 2021Quote: ... and polyclonal anti-rabbit IgG-HRP raised in goat (R1364HRP, 1:5,000; OriGene, Herford, Germany)
-
bioRxiv - Bioengineering 2022Quote: ... A 1:60 dilution of HER2 expressing whole cell lysate in RIPA buffer (Origene LY417979), or a lysate control (Origene LY500001) ...
-
bioRxiv - Cancer Biology 2020Quote: ... A primary mouse monoclonal Lysyl Hydroxylase 2 (LH2) antibody (Origene; Cat# TA803224, dilution 1:150) was used for the immunohistochemical staining.
-
bioRxiv - Cell Biology 2022Quote: ... Lentivirus containing supernatant was concentrated 1:50 as described by the manufacturer (Origene, catalog # TR30026), flash frozen in liquid nitrogen and stored at −80°C ...
-
bioRxiv - Biochemistry 2019Quote: ... Cells were then incubated with 1:100 dilution of anti-La (Origene Technologies, #TA-00406) and 1:100 dilution of anti-Rab7 (Santa Cruz ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 μl Lipofectamine 2000 was mixed with 1 μg of each HA-ZNF804A (Origene, RG211363) or Myc-NT5C2 (Origene ...
-
bioRxiv - Cancer Biology 2022Quote: ... along with 1 μg of pCMV-Entry-Empty or pCMV-Entry-ETV7 plasmid (Origene and(20)) ...
-
bioRxiv - Cancer Biology 2019Quote: ... The KDELR3 shRNA recognition sequence was edited (t210c_c213a_t216c_t219c_a222c) from Myc-DDK-tagged KDELR3 transcript variant 1 construct (RC201571, OriGene). TOPO cloning was used to clone place this sequence into the Gateway cloning system and the pENTR L1/L2 plasmid was combined with C413-E19 pPol2 L4/R1 and pDEST-658 R4/R2 destination plasmids ...
-
bioRxiv - Cell Biology 2020Quote: ... the samples were immunostained with the anti-IRSp53/BAIAP2 antibody 1D9 (mouse monoclonal, 1:200, OriGene) and anti-HLA A antibody EP1395Y (rabbit monoclonal ...
-
bioRxiv - Immunology 2023Quote: ... tagged ADA2 was pulled down using 1 µg anti-DDK (FLAG) clone OTI4C5 (#TA50011, OriGene Technologies). An isotype control sample was incubated with 1 µg mouse IgG1 (#02-6100 ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary and secondary antibodies were used at the following concentrations: anti-dendra2 1:5000 (OriGene: TA150090), anti-Slack 1:5000 (Aves labs ...
-
bioRxiv - Cell Biology 2019Quote: ... BMP2K (1-560) and BMP2K (561-1161) were PCR amplified from the template ORF clone # RC215795 (Origene) and inserted into HindIII restriction site of pEGFP-N1 vector using In-Fusion cloning technology (Clontech ...
-
bioRxiv - Cancer Biology 2021Quote: Purified RPRM peptides (77-109, ChinaPeptides; 1 μg) were incubated with purified recombinant CDK4 (Origene; 0.2 μg) and CDK6 proteins (Origene ...
-
bioRxiv - Neuroscience 2021Quote: ... For knockdown experiments four pGFP-C-shLenti vectors containing different shRNAs against Skap2 (Origene; see Table 1) were applied and scrambled shRNA was used as control (OriGene ...
-
bioRxiv - Neuroscience 2022Quote: ... were double immunostained using the following antisera couples: a) rabbit polyclonal anti-GLP-1R (1:50; Origene) and mouse monoclonal anti-NUCB2/nesfatin-1 antibody (1:50 ...
-
bioRxiv - Cell Biology 2023Quote: ... EGFP was cloned at the C terminus of the coding sequence of Pitx2 isoform 1 (Origene; MR227617). Lentivirus particles were generated as previously described 69 ...
-
bioRxiv - Cell Biology 2023Quote: ... and GFP tagged plasmid with JPh44 translating region (GFP-Δ(1-240) JPh1) were created by OriGene Technologies (Rockville ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by incubation overnight at 4°C with primary antibodies against GFP (1:100, TP401; OriGene Technologies) (Fig 1B) ...
-
bioRxiv - Cell Biology 2019Quote: ... 5% heat-inactivated goat serum) and incubated with primary antibody (1:1000 anti-DDK monoclonal 4C5; OriGene Technologies) in PBT1 at 4°C overnight ...
-
bioRxiv - Developmental Biology 2021Quote: ... at 56°C for 40min and re-probed with anti–GFP antibody for 1h (1:1000, Origene R1091P). Band intensity was measured using the histogram function on the Fiji software ...
-
bioRxiv - Immunology 2022Quote: Lung section slides were also stained with 1 µg/mL rabbit polyclonal anti-NEU1 (TA335236; Origene, Rockville, MD), anti-NEU2 (TA324482 ...
-
bioRxiv - Biophysics 2024Quote: The mouse LRMP construct in PCMV6-Kan/Neo (GenBank AAH52909.1; Cat. #MC228229, Origene, Rockville, MD; Supplementary Figure 1), HCN1 in pcDNA3 (generously provided by Dr ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were incubated with a mixture of primary rabbit anti–GFP antibody (1:500; catalog #SP3005P, OriGene, Rockville, MD) and mouse anti–NeuN antibody (1:1000 ...
-
bioRxiv - Immunology 2019Quote: ... 31) and myc-FLAG-tagged Syncytin-1 and 2 expression constructs in the pCMV6 vector were purchased from Origene. pFR-Luc and pBD-NFkB (Agilent ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was then incubated overnight at 4°C with a mouse monoclonal anti-mCherry antibody (Origene; 1:1500) diluted in 5% milk in PBS ...
-
The transcriptomic landscape of monosomy X (45,X) during early human fetal and placental developmentbioRxiv - Genetics 2024Quote: ... then incubation was undertaken with a primary rabbit polyclonal CSF2RA (GM-CSF receptor alpha) antibody for 1 hour (Origene TA323990S ...
-
bioRxiv - Cancer Biology 2021Quote: ... pLKO.1-puro or pLKO.1 plasmids encoding target shRNA constructs (Supplemental Table 4; selected from TRC shRNA Library, Broad; purchased from Origene) were cloned as previously described ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1-2272) were expressed with a C-terminal Myc-DDK (FLAG) tag from a pCMV6-Entry backbone (#RC218208, Origene, USA) in Expi 293F suspension cells (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... the small hairpin (shRNA)-expressing vectors pSUPER.neo (R4-1) (Fleig et al., 2012) and a pRS vector-based construct targeting 5’- ATGAGGAGACAGCGGCTTCACAGATTCGA-3’ (R4-2) (OriGene) were used ...
-
bioRxiv - Immunology 2019Quote: ... 1 mg of whole-cell extracts (200 μl) were incubated overnight with 1 μg of an anti-flag mouse monoclonal antibody (Origene) at 4 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... we obtained a clone expressing full-length (residues 1-1106) untagged GLI1 in the pCMV6-XL5 vector backbone from OriGene Technologies (catalog number SC125780) ...
-
bioRxiv - Genetics 2023Quote: ... Sections were incubated overnight at 4 °C with an anti-Cnn1 rabbit monoclonal primary antibody (1:400 dilution; TA327614; Origene), or a CD68 rabbit polyclonal antibody (1:300 dilution ...
-
bioRxiv - Cancer Biology 2023Quote: ... The gRNA sequence CTAGAGGAGGAGATCCCGTC (TGG) in exon 1 of ABI1 was cloned into a pCas-Guide-EF1a-GFP vector (cat. #: GE100018) from Origene Technologies (Rockville ...
-
bioRxiv - Cell Biology 2023Quote: ... Golgin-45-HA-MAO was generated by >90% of the cell population was further confirmed through flow Gibson assembly using the HA-MAO vector digested with NheI/KpnI and golgin-45 cDNA (missing its C-ter, amino acids 1 to 368) purchased from Origene.
-
bioRxiv - Neuroscience 2024Quote: ... The membranes were incubated with the following primary antibodies overnight at 4°C: mouse anti-DPP9 (Origene, TA503937, 1:1000). After three washes with TBST ...