Labshake search
Citations for American BioInnovations, :
51 - 100 of 239 citations for PCR Strips since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Quantitative PCR (qPCR) was performed by ABI Quant Studio 3 series PCR machine (Applied Biosystem ...
-
bioRxiv - Molecular Biology 2021Quote: Quantitative real-time RT-PCR (qPCR) was performed using the 7500 Fast Real-Time PCR system (ABI Biosystems, USA). Gene-specific primers designed for exon-exon junctions were used for qPCR ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative real-time PCR reactions were performed on an Applied Biosystems QuantStudio 6 Flex Real-Time PCR Instrument (ABI). Delta-delta-cycle threshold (ΔΔCT ...
-
bioRxiv - Pathology 2022Quote: ... Real-time PCR was carried out in an Applied Biosystems QuantStudio 5 Real-Time PCR System (ABI, Warrington, UK) with SYBR Green PCR master mix (Takara ...
-
bioRxiv - Neuroscience 2019Quote: The qPCR reactions were performed with samples in triplicate on an ABI 7500 fast real-time PCR system using power SYBR green PCR master mix (ABI). The mouse TRPV1 cDNA was amplified with primers 5’-TTCCTGCAGAAGAGCAAGAAGC-3’ and 5’-CCCATTGTGCAGATTGAGCAT-3’ (Albers et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... qRT-PCR reactions were performed with the TOYOBO SYBR Green Realtime PCR Master Mix (TOYOBO) and analyzed with a step-one Plus PCR system (ABI). Lotus Ubiquitin (Lj5g3v2060710.1 ...
-
bioRxiv - Immunology 2023Quote: ... PCR amplification was performed by using RT-PCR in the presence of SYBR green in a 7500 Fast Realtime PCR System (ABI). Specific primers were designed with Primer Express 2.0 (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... was performed using SYBR Green Real-time PCR Master Mix (QPK-201, Toyobo) with the QuantStudio 6 Flex multicolor real-time PCR detection system (ABI). Relative mRNA levels were normalized to GAPDH levels and calculated using the 2-ΔΔCT method (Livak & Schmittgen ...
-
bioRxiv - Immunology 2021Quote: ... in a 7500 Fast Realtime PCR System (ABI). Specific primers were designed with Primer Express 2.0 (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Probes for quantititative PCR were purchased from ABI: hypoxanthine-guanine phosphoribosyl transferase 1 (HPRT ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time PCR reactions were measured by ABI StepOnePlus system using SYBR green qPCR master mix (ThermoFisher) ...
-
bioRxiv - Plant Biology 2021Quote: ... The qRT-PCR reaction system (ABI QuantStudio 3) included ...
-
bioRxiv - Developmental Biology 2020Quote: ... in a 7300 real-time PCR system (ABI). For data analysis the simplified method after Pfaffl (88 ...
-
bioRxiv - Microbiology 2020Quote: ... Real-time PCR was done on 7900HT (ABI) machine using Fast Fire qPCR Premix (Probe ...
-
bioRxiv - Neuroscience 2019Quote: ... PCR was performed on an Applied Biosystems (ABI) 9600 thermocycler using TAAR1 specific primers (Forward 5’ CCTGATTATGGATTTGGGAAAA 3’ Reverse 5’ TCATAAAGGTCAGTACCCCAGA 3’ ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... PCR was performed using ABI7900HT (ABI Company, USA) according to established methods ...
-
bioRxiv - Cell Biology 2020Quote: ... in a 7500FAST real-time PCR system (ABI) as previously described (46) ...
-
bioRxiv - Genetics 2023Quote: ... qRT-PCR was performed (ABI-Q6, California, USA) in a 20 µL reaction ...
-
bioRxiv - Microbiology 2023Quote: ... PE5700 automatic fluorescent quantitative PCR analyzer (ABI, USA); CKX41 inverted microscope (Olympus ...
-
bioRxiv - Molecular Biology 2024Quote: ... ; one Step RT-PCR Kit purchased from ABI ...
-
bioRxiv - Physiology 2019Quote: ... Quantitative real-time PCR assays were performed under a Real-time PCR Detection System of QuantStudio™6 Flex (ABI, USA) in a 384-well plate format using SYBR Green PCR (TOYOBO ...
-
bioRxiv - Neuroscience 2022Quote: ... Real-time quantitative PCR (RT-qPCR) reactions were performed in the Quant Studio6 Flex Real Time PCR System (ABI, Thermo Fisher) using the SYBR Select PCR Master Mix (ABI ...
-
bioRxiv - Microbiology 2023Quote: ... Quantitative real-time reverse transcription PCR (RT-qPCR) was performed using the SYBR Green Real-Time PCR Master Mix and the Step One Plus (ABI, USA) Real-Time PCR System ...
-
ARID1a protects against steatosis and insulin resistance via PPARalpha-mediated fatty acid oxidationbioRxiv - Cell Biology 2019Quote: RNA extracted from liver or hepatocytes were subjected to reverse transcription and subsequent PCR using a real-time PCR system (ABI, Carlsbad, CA). PCR primer sequences are listed in Supplemental Table 1 ...
-
bioRxiv - Immunology 2021Quote: ... and quantified by real time PCR (ABI Applied Biosystem) as in 53 ...
-
bioRxiv - Cell Biology 2019Quote: ... ABI Power SYBR Green PCR Master Mix (ABI, USA) was used in conjunction with a PCR machine model ABI StepOne Plus Real-time PCR (Applied Biosystems) ...
-
bioRxiv - Physiology 2021Quote: ... was used on ViiA7 Real-Time PCR systems (ABI). The ΔΔCt method was used to analyze the relative changes in gene expression ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and the StepOnePlus™ Real-Time PCR System (ABI). Primer sequences ...
-
bioRxiv - Cell Biology 2020Quote: ... and the StepOnePlus Real-Time PCR System (ABI, USA), following the manufacturers’ manuals ...
-
bioRxiv - Cell Biology 2020Quote: ... and the StepOnePlus Real-Time PCR System (ABI, USA) following the manufacturers’ manuals ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Purified PCR products were cycle sequenced using BigDye (ABI PRISM® BigDye Terminator v3.1 Cycle Sequencing Kits ...
-
bioRxiv - Neuroscience 2022Quote: ... SYBR-green PCR (Fast SYBR green master mix, ABI) was used to amplify Gapdh and Myod1 ...
-
bioRxiv - Microbiology 2022Quote: ... in a StepOnePlus Real-Time PCR system (ABI, 4376600) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR amplification was performed with the Applied Biosystems (ABI) BigDye Direct kit PCR master mix or NEB OneTaq standard buffer ...
-
bioRxiv - Physiology 2023Quote: ... on a StepOnePlus Real Time PCR workstation (Thermo/ABI). Libraries were sequenced on a NovaSeq 6000 (Illumina) ...
-
bioRxiv - Molecular Biology 2023Quote: ... on a StepOnePlus real time PCR workstation (Thermo/ABI). Libraries were sequenced on a NovaSeq 6000 (Illumina) ...
-
bioRxiv - Molecular Biology 2023Quote: Real-time PCR was performed as reported previously (Tan et al., 2019) using the QuantStudio 6 Flex Real-Time PCR System (ABI, Thermo Fisher, Shanghai, China) and Roche LightCycler® 480 (Roche ...
-
bioRxiv - Genomics 2019Quote: ... on the QuantStudio 12K Flex Real-Time PCR System (ABI). Relative expression levels were defined using the DDCt method and normalising to 36B4/RPLP0 ...
-
bioRxiv - Cell Biology 2021Quote: ... Real-time PCR was performed on an Applied Biosystems (ABI) ViiA 7 Real-Time PCR System. ...
-
bioRxiv - Plant Biology 2021Quote: ... Conditions for sRT-PCR on Veriti Thermal Cycler (ABI, USA) were as follows ...
-
bioRxiv - Plant Biology 2021Quote: ... and a Viia7 real-time PCR instrument (Life Technologies/ABI). Gene-specific primers are listed in Table S1 ...
-
bioRxiv - Physiology 2021Quote: ... SYBR green was used to perform qRT-PCR (ABI 7900). For each primer set ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR with SYBR green PCR master mix (ABI, Foster, CA) was performed in an ABI 9700 real-time PCR system ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real-time PCR was performed on an Applied Biosystems (ABI) ViiA 7 Real-Time PCR System with the thermal-cycling protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... The thermo-cycling of qPCR (ABI 7500 Real-Time PCR) was performed at 95 °C ...
-
Germline Selection by Meiosis Defends the Transmission of defective Mitochondria with mtDNA variantsbioRxiv - Cell Biology 2020Quote: ... the PCR products were sequenced using 3730xl DNA Analyzer (ABI). Electropherograms were inspected and aligned to the revised Cambridge reference sequence (NC_012920 ...
-
bioRxiv - Microbiology 2019Quote: ... PCRs were performed in Applied Biosystems 2720 Thermak thermocycler (ABI). Nucleotide sequences of all constructs were determined by MWG - Eurofins (Germany).
-
bioRxiv - Molecular Biology 2020Quote: ... The RT-PCR was performed using a thermo cycler (ABI 7500 Real-Time PCR ...
-
bioRxiv - Cancer Biology 2021Quote: ... qRT-PCR was carried out using Fast Sybr green (ABI). Ct values were exported ...
-
bioRxiv - Neuroscience 2022Quote: ... using the SYBR Select PCR Master Mix (ABI, Thermo Fisher) with ten-fold dilution of cDNA and 200 nM of each primer pair as listed in Supp ...