Labshake search
Citations for American BioInnovations, :
1 - 50 of 62 citations for Medium Kit without Serum and with CultureBoost R since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... the adventitious bud induction medium (ABI) was use d (Wood Plant medium [WPM] + 1 mg·L-1 6-BA ...
-
bioRxiv - Microbiology 2021Quote: ... All cells were supplemented with 10% (v/v) fetal calf serum (FCS) (ABI) at 37 °C in 5% CO2 ...
-
bioRxiv - Genetics 2020Quote: ... followed by PCR amplification (ncoa3CRISPR F: FAM-ATGAATGAGCAAGGCCACAT; ncoa3CRIPSR R: GGACTTGCTCCCATTTTAGG) and subjected to fragment length analysis (ABI 3500) to test gRNA efficiency (90% efficiency rate detected) ...
-
bioRxiv - Molecular Biology 2022Quote: ... one tenth culture volume of Cell Booster medium (ABI Scientific, VA) was added to each flask of transfected cells and cell cultures were incubated at 120 rpm ...
-
bioRxiv - Bioengineering 2021Quote: ... The images were obtained with a system developed in-house consisting of two red LED lamps (610-630 nm, GR-PAR38-12W-R-1, ABI, Indianapolis, IN) for excitation ...
-
bioRxiv - Genetics 2023Quote: ... and these transiently transformed plants were cut into explants and cultured in an ABI medium for inducing buds (ABI +300 mg/L cefotaxi me sodium +1 mg/L AgNO3) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Quant-iT PicoGreen dsDNA Assay Kit (ABI), First Strand cDNA Synthesis Kit (Servicebio) ...
-
bioRxiv - Cancer Biology 2022Quote: ... High capacity cDNA synthesis kit (ABI cat#4368813), TaqMan qPCR primer probe set ABI ...
-
bioRxiv - Molecular Biology 2024Quote: ... ; one Step RT-PCR Kit purchased from ABI ...
-
bioRxiv - Neuroscience 2021Quote: ... we used High-Capacity cDNA Reverse Transcription kit (ABI) with RNAses inhibitors to reversely transcribed RNA into cDNA ...
-
bioRxiv - Microbiology 2021Quote: ... the BigDye Teminator V3.1 Cycle Sequencing Kit (ABI, USA) was used to extract the total DNA of strain D ...
-
bioRxiv - Zoology 2019Quote: ... and Big dye terminator sequencing kit (ABI Prism, USA), and a 614 base pairs length of 5 sequences of cytochrome c oxidase subunit 1 (COI ...
-
bioRxiv - Neuroscience 2020Quote: ... High Capacity cDNA Reverse Transcription Kit (#4368814) was from ABI/Thermo (Waltham ...
-
bioRxiv - Cancer Biology 2024Quote: ... the libraries were quantified (KAPA Library Quantification Kit (Illumina/ABI Prism), normalized ...
-
bioRxiv - Neuroscience 2020Quote: ... We used the High Capacity cDNA Reverse Transcription Kit (#4368814) from ABI/Thermo Fisher per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... cDNA was synthesised using the High Capacity RNA-to-cDNA kit (ABI) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Reverse transcription was performed using a highcapacity RNA-cDNA kit (Applied Biosystems [ABI]) with 1 μg RNA per 20 μL reaction ...
-
bioRxiv - Neuroscience 2019Quote: ... cDNA was generated using the High-Capacity cDNA Reverse Transcription Kit (ABI, # 4368814).
-
bioRxiv - Molecular Biology 2023Quote: ... Complementary DNA was produced using the High-Capacity cDNA Reverse Transcription kit (ABI) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (ABI). Power SYBR Master Mix (ABI ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA was prepared using 10 µL RNA (High Capacity cDNA Reverse Transcription kit, ABI). The Light Cycler 480 probe master kit (Roche ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reverse transcription reaction was carried out using High Capacity cDNA Reverse Transcription Kit (ABI), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Ex-protein fractions using TaqMan microRNA Reverse transcription kit (ABI 4366597 Lot#00636931), TaqMan miRNA stem-loop RT primers/qPCR primer probe set (ABI 4427975) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Reverse transcription was carried out using High-Capacity cDNA Reverse Transcription Kit (ABI, 4368814) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... and RISC-Poor (36-47) using TaqMan microRNA Reverse transcription kit (ABI 4366597 Lot#00636931), TaqMan miRNA stem-loop RT primers/qPCR primer probe sets (ABI 4427975 ...
-
bioRxiv - Neuroscience 2021Quote: ... for reverse transcription with the High-Capacity cDNA Reverse Transcription Kits (ABI Applied Biosystems, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (ThermoFisher, ABI 4368814). PCSK9 mRNA expression was assessed by real-time PCR using PCSK9 primer sets 5’-TGTCTTTGCCCAGAGCATC-3’ and 5’-GTCACTCTGTATGCTGGTGTC-3 (Integrated DNA Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... and reverse transcription was performed using a high-capacity RNA-cDNA kit (Applied Biosystems [ABI]) with 1 μg RNA per 20 μl reaction ...
-
bioRxiv - Immunology 2019Quote: ... or whole blood (PAXgene Blood RNA Kit) and reverse-transcribed (ABI High Capacity Reverse Transcriptase). The expression of ISGs (IFIT1 ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was obtained by reverse transcription using the High-capacity cDNA Reverse Transcription Kits (ABI). Samples were analyzed by real-time PCR with GoTaq qPCR Master Mix (Promega ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was obtained by reverse transcription using the High-capacity cDNA Reverse Transcription Kits (ABI). Samples were analyzed by real-time PCR with LightCycler Taqman Master (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: The sequencing reaction was carried out using Big dye Terminator v3.1 cycle sequencing kit (ABI, 4337454) in 10μl volume (containing 0.5μl purified DNA ...
-
bioRxiv - Neuroscience 2019Quote: ... cDNA was generated in 20 µl reactions using High-Capacity Reverse Transcriptase kit (ABI, Thermo Fisher). Quantitative real time PCR (qRT-PCR ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was prepared from 1 μg total RNA using the high-capacity reverse transcription kit (ABI) according to the manufactures’ instructions ...
-
bioRxiv - Physiology 2022Quote: ... Reverse transcription was performed using the Taqman® Reverse Transcription kit (Life Technologies/ABI, Rotkreuz, CH). Real-time PCR was performed using presynthesized Taqman®-based Assays-on-Demand (Life Technologies/ABI ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting PCR products were sequenced directly using the Big Dye Terminator Cycle Sequencing kit (ABI) and the ABI 377 sequencer.
-
bioRxiv - Cancer Biology 2023Quote: ... 1 µg total RNA was reverse transcribed using the cDNA archive kit (Applied Biosystems – ABI, USA) following manufacturer’s instructions and the resulting cDNA was used as a template for Real Time PCR analysis ...
-
bioRxiv - Biochemistry 2024Quote: ... cDNA was generated with random oligomer primers by using cDNA reverse transcription kit (ABI Biosystems #4368814). qRT reaction was carried out using and Sybr Green master mix (ABI Biosystems #4309155 ...
-
bioRxiv - Neuroscience 2023Quote: ... Reverse transcription was performed with the High-Capacity cDNA Reverse Transcription Kit (ABI, New York, NY, USA). Messenger RNA levels were quantified by using the StepOnePlus Real-Time PCR System with Fast SYBR Green Master Mix (ABI) ...
-
bioRxiv - Cell Biology 2020Quote: ... and cDNA was synthesized using 500-1000 ng RNA and the High-capacity cDNA reverse transcription kit (ABI) according to the manufacturer’s instruction ...
-
bioRxiv - Immunology 2019Quote: ... Reverse transcription was conducted at 50°C for 15 min using the High Capacity Reverse Transcription kit (ABI) and 10-50 ng total RNA ...
-
bioRxiv - Microbiology 2019Quote: ... Supernatants were titered by measuring p24gag levels with an HIV-1 p24 antigen capture assay kit (ABI#5447), and also by TZM-bl assay.
-
bioRxiv - Microbiology 2019Quote: We adapted the AFLP protocol of the Applied Biosystems Microbial Fingerprinting Kit (Applied Biosystems [ABI], Foster City, CA, USA) for use with our samples ...
-
bioRxiv - Microbiology 2021Quote: ... They were quantitated by quantitative polymerase chain reaction (qPCR) using a Roche KAPA Library Quantification Complete Kit (ABI Prism), and run on the Applied Biosystems QuantStudio 5 Real-Time PCR System.
-
bioRxiv - Genetics 2020Quote: Assays using the GPS™ COVID-19 dtec-RT-qPCR kit (Alicante, Spain) were prepared and reaction mixtures were subjected to qPCR in a QuantStudio3 (ABI) as described in the manual provided ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA was generated from 2 μg RNA in 20 μl reactions using High-Capacity Reverse Transcriptase kit (ABI, Thermo Fisher). Real-time quantitative PCR (RT-qPCR ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cDNA was synthesized by reverse transcription of 400 ng of RNA using the High Capacity cDNA Transcription Kit (ABI) with random primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... A total of 500ng RNA was reverse transcribed to cDNA using the ABI high-capacity cDNA archive kit (ABI # 4322171) as per the manufacturer’s protocol.
-
bioRxiv - Immunology 2021Quote: ... The DNA sequence of the cloned devil CIITA transcript was verified by Sanger sequencing using Big Dye™ Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems (ABI), Foster City ...
-
bioRxiv - Microbiology 2021Quote: ... was amplified and detected by SYBR Green PCR Master Mix kit (bao bio-engineering Co., Ltd, China) on the ABI7500 instrument (ABI, USA). For qRT-PCR reactions ...