Labshake search
Citations for American BioInnovations, :
1 - 50 of 63 citations for 6H Pyrrolo 1 2 1 2 imidazo 4 5 f 2 1 3 benzoxadiazole 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... and then 1–2 μg RNA was reverse-transcribed by random hexamer priming and Multi Scribe reverse transcriptase (ABI). Amplification was performed using the primers ...
-
bioRxiv - Bioengineering 2020Quote: ... The media were collected from the upper channel at different time points (0 h, 1 h and 2 h) and the fluorescence intensity was measured using microplate system (ABI Vii 7).
-
bioRxiv - Molecular Biology 2021Quote: ... The cDNA was further diluted by 1/3 and 1/10 in ROX350/HiDi and samples loaded onto capillary electrophoresis sequencers (ABI-3730) on capillary electrophoresis (CE ...
-
bioRxiv - Neuroscience 2023Quote: ... was used to perform qPCR using 2× Takara TB Green Mastermix (ABI), and the respective specific primers are shown in Table 1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Gene expression was conducted using the 2^-deltadeltaCT method using ViiA qPCR system (ABI) following MIQE guidelines [17] ...
-
bioRxiv - Immunology 2020Quote: ... the relative standard curve method (see Applied Biosystems User Bulletin #2 https://www.gu.se/digitalAssets/1125/1125331_ABI_Guide_Relative_Quantification_using_realtime_PCR.pdf ...
-
bioRxiv - Immunology 2020Quote: ... the relative standard curve method (see Applied Biosystems User Bulletin #2 https://www.gu.se/digitalAssets/1125/1125331_ABI_Guide_Relative_Quantification_using_realtime_PCR.pdf ...
-
bioRxiv - Neuroscience 2022Quote: Aliquots (2 μl) of samples were used for MALDI-TOF/TOF MS (ABI 4800 model, Applied Biosystems) measurements ...
-
bioRxiv - Cell Biology 2021Quote: ... PCSK9 mRNA expression was assessed by real-time PCR using PCSK9 primer sets 5’-TGTCTTTGCCCAGAGCATC-3’ and 5’-GTCACTCTGTATGCTGGTGTC-3 (Integrated DNA Technologies) and SYBR Select Master Mix (ThermoFisher, ABI 4472908).
-
Quantitative three-dimensional nondestructive imaging of whole anaerobic ammonium-oxidizing bacteriabioRxiv - Cell Biology 2019Quote: ... The V3-V4 regions of the anammox 16S rRNA gene were amplified with the primer 338F (5’-ACTCCTACGGGAGGCAGCAG-3’) and the primer 806R (5’-GGACTACHVGGGTWTCTAAT-3’) using polymerase chain reaction (PCR) (ABI GeneAmp 9700). The PCR program was as follows ...
-
bioRxiv - Neuroscience 2021Quote: ... The protocol followed the manufacturer’s recommendations with the exception of using 2 μl for each RT primer (ABI) in a 10 μl total reaction volume (i.e. ...
-
bioRxiv - Immunology 2023Quote: ... 2 μl of cDNA were added to 23 μl of PCR mixture containing 2xSYBR Green Master Mix (ABI) and 0.2 μM of forward and reverse primers ...
-
bioRxiv - Genetics 2021Quote: ... the QTR locus in TCERG1 was amplified by PCR using a fluorescently-labelled forward (5’-FAM-AACTGACACCTATGCTTG-3’) and unlabelled reverse (5’-GTTGAAGTGGATACTGCA-3’) primer before sizing by capillary electrophoresis (ABI 3730 genetic analyzer) and Genescan against a LIZ600 ladder of size standards (Thermofisher) ...
-
bioRxiv - Immunology 2022Quote: ... The hypervariable region V3-V4 of the bacterial 16S rRNA gene was amplified with primer pairs 338F (5’-ACTCCTACGGGAGGCAGCAG-3’) and 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by an ABI Gene Amp® 9700 PCR thermocycler (ABI, CA, USA). The PCR reaction mixture included 4 μL 5× Fast Pfu buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... Each ChIP sample and a range of dilutions of the corresponding input sample (0.01 – 2% input) were quantitatively analyzed with gene-specific primers using the StepOnePlus System (ABI) and SYBR qPCR Powermix (ABI).
-
bioRxiv - Neuroscience 2021Quote: ... Each ChIP sample and a range of dilutions of the corresponding input sample (0.01 – 2% input) were quantitatively analyzed with gene-specific primers using the StepOnePlus System (ABI) and SYBR qPCR Powermix (ABI) ...
-
bioRxiv - Neuroscience 2020Quote: ... Each ChIP sample and a range of dilutions of the corresponding input sample (0.01 – 2% input) were quantitatively analyzed with gene-specific primers using the 7500 detection system (ABI) and SYBR qPCR Premix (Clontech) ...
-
bioRxiv - Neuroscience 2021Quote: ... Synthesized cDNA was used for qPCR by 2× ChamQTM Universal SYBR qPCR Master Mix (Vazyme) on StepOnePlusTM Real-Time PCR System (ABI) or BioRad CFX96 Touch Real-Time PCR system ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA was generated from 2 μg RNA in 20 μl reactions using High-Capacity Reverse Transcriptase kit (ABI, Thermo Fisher). Real-time quantitative PCR (RT-qPCR ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2 μl diluted cDNA in Optical 8-Tube Strip using the Applied Biosystems 7300 Real-Time PCR Instrument (ABI, USA). The conditions for real-time PCR were as follows ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were verified by 2% agarose electrophoresis gel and subjected to sequencing by using a 3730XL DNA Analyzer (ABI, USA).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 1-10 ng template in 9 μl Nuclease-free water were added to 10.0 μL of 2× TaqMan® Universal PCR master mix (ABI/Life technologies, USA) and 1.0 μL of a 20× combined primers and probes mix (ABI/Life Technologies ...
-
bioRxiv - Genomics 2021Quote: ... and Silencer Select Negative Control #1 siRNA (ABI) and Nuclease Free Water (ABI ...
-
bioRxiv - Neuroscience 2021Quote: ... F Treatment with ABI (Sham+ABI and GDX+ABI pooled) reduced the number of overall errors ...
-
bioRxiv - Neuroscience 2021Quote: ... F Treatment with ABI (Sham+ABI and GDX+ABI pooled) reduced the number of overall errors ...
-
bioRxiv - Molecular Biology 2021Quote: ... and DNA sequences were determined with a 3130×1 DNA Sequencer (ABI). Transfection was performed using Lipofectamine LTX and PLUS Reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... including optimized mouse primers (Supplementary Table 1) on a ViiA7 (Thermofisher/ABI). Cycles consisted of an initial incubation at 50° C and 95° C for 2 and 10 minutes respectively ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was prepared from 1 μg total RNA using the high-capacity reverse transcription kit (ABI) according to the manufactures’ instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 µg total RNA was reverse transcribed using the cDNA archive kit (Applied Biosystems – ABI, USA) following manufacturer’s instructions and the resulting cDNA was used as a template for Real Time PCR analysis ...
-
bioRxiv - Genetics 2022Quote: ... by QuantStudio 3 (ABI). The detailed method was followed by Iijima et al ...
-
bioRxiv - Microbiology 2019Quote: ... The viral loads in organs were determined using TaqMan fast virus 1-step master mix (ABI, USA). One step RT-PCR was also performed to amplify viral RNA from the organs using MyTaq One-Step RT-PCR kit (Bioline ...
-
bioRxiv - Genetics 2020Quote: ... The assay follows the protocol published by the WHO (https://www.who.int/docs/default-source/coronaviruse/protocol-v2-1.pdf) and uses the 7500 Fast Dx instrument (ABI) and 7500 SDS software (ABI) ...
-
bioRxiv - Microbiology 2019Quote: ... Supernatants were titered by measuring p24gag levels with an HIV-1 p24 antigen capture assay kit (ABI#5447), and also by TZM-bl assay.
-
bioRxiv - Neuroscience 2021Quote: ... We performed qPCR using 1 μL of cDNA with 7.60 µl of Taqman Universal PCR Master Mix (with No Amperase UNG, ABI) and 0.75 µl of miRNA-specific PCR TaqMan MicroRNA probes (20X ...
-
bioRxiv - Immunology 2022Quote: ... 95°C for 10 min, 40 cycles of 15 s at 95°C, and 60°C for 1 min; ABI PRISM 7000 Sequence Detection System ...
-
bioRxiv - Genetics 2020Quote: ... followed by PCR amplification (ncoa3CRISPR F: FAM-ATGAATGAGCAAGGCCACAT; ncoa3CRIPSR R: GGACTTGCTCCCATTTTAGG) and subjected to fragment length analysis (ABI 3500) to test gRNA efficiency (90% efficiency rate detected) ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl of each replicate was analyzed by nested quantitative PCR (45 cycles of 95°C for 15 seconds and 60°C for 1 minute) using Fast Advanced Master Mix (ABI Life Technologies) in an ABI StepOnePlus Real-Time PCR machine ...
-
bioRxiv - Bioengineering 2021Quote: ... The images were obtained with a system developed in-house consisting of two red LED lamps (610-630 nm, GR-PAR38-12W-R-1, ABI, Indianapolis, IN) for excitation ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of each replicate was analyzed by nested quantitative PCR (45 cycles of 95 C for 15 seconds and 60 ℃ for 1 minute) using Fast Advanced Master Mix (ABI Life Technologies) in an ABI StepOnePlus Real-Time PCR machine ...
-
bioRxiv - Plant Biology 2021Quote: ... The qRT-PCR reaction system (ABI QuantStudio 3) included ...
-
bioRxiv - Genomics 2022Quote: ... was used for RSV subtype detection with TaqPath 1-Step Multiplex Master Mix (No ROX) on Applied Biosystems 7500 Real-Time PCR System (ABI, Life Technologies, Waltham, MA) as instructed ...
-
bioRxiv - Neuroscience 2022Quote: ... detector system (ABI Quant studio 5) and the SYBR Green detection protocol ...
-
bioRxiv - Genomics 2020Quote: ... sequencing using universal primers (Table 1) followed by sequencing at First Base Laboratories SdnBhd (Malaysia) using Applied Biosystems highest capacity-based genetic analyzer (ABI PRISM® 377 DNA Sequencer) platforms with the BigDye® Terminator v3.1 cycle sequencing kit chemistry [38] ...
-
bioRxiv - Genomics 2020Quote: ... AFP4/TMAC2 (ABI FIVE BINDING PROTEIN 4, AT3G02140), DOG1 (AT5G45830 ...
-
bioRxiv - Physiology 2022Quote: ... employing the QuantStudio® 3 Real-Time PCR systems (ABI). qPCR primers are shown in Table S1.
-
bioRxiv - Molecular Biology 2023Quote: ... The reaction was conducted on Applied Biosystems® QuantStudio 3 (ABI, USA) following the conditions ...
-
bioRxiv - Neuroscience 2021Quote: All 4 groups (Sham+Vehicle, Sham+ABI, GDX+Vehicle, GDX+ABI) were habituated for 1 week to 1 g Vehicle ...
-
bioRxiv - Neuroscience 2021Quote: All 4 groups (Sham+Vehicle, Sham+ABI, GDX+Vehicle, GDX+ABI) were habituated for 1 week to 1 g Vehicle ...
-
bioRxiv - Cancer Biology 2022Quote: ... and real-time quantitative PCR (QuantStudio ™ 3 Real-Time PCR System, ABI, USA).
-
bioRxiv - Microbiology 2020Quote: ... followed by 5 min on ice and then analyzed by ABI Prism 3730XL DNA analyzer (Applied Biosystems ...