Labshake search
Citations for American BioInnovations, :
1 - 50 of 66 citations for 6H 1 3 5 Trioxepino 6 7 f benzimidazole 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... PCSK9 mRNA expression was assessed by real-time PCR using PCSK9 primer sets 5’-TGTCTTTGCCCAGAGCATC-3’ and 5’-GTCACTCTGTATGCTGGTGTC-3 (Integrated DNA Technologies) and SYBR Select Master Mix (ThermoFisher, ABI 4472908).
-
Quantitative three-dimensional nondestructive imaging of whole anaerobic ammonium-oxidizing bacteriabioRxiv - Cell Biology 2019Quote: ... The V3-V4 regions of the anammox 16S rRNA gene were amplified with the primer 338F (5’-ACTCCTACGGGAGGCAGCAG-3’) and the primer 806R (5’-GGACTACHVGGGTWTCTAAT-3’) using polymerase chain reaction (PCR) (ABI GeneAmp 9700). The PCR program was as follows ...
-
bioRxiv - Genetics 2021Quote: ... the QTR locus in TCERG1 was amplified by PCR using a fluorescently-labelled forward (5’-FAM-AACTGACACCTATGCTTG-3’) and unlabelled reverse (5’-GTTGAAGTGGATACTGCA-3’) primer before sizing by capillary electrophoresis (ABI 3730 genetic analyzer) and Genescan against a LIZ600 ladder of size standards (Thermofisher) ...
-
bioRxiv - Immunology 2022Quote: ... The hypervariable region V3-V4 of the bacterial 16S rRNA gene was amplified with primer pairs 338F (5’-ACTCCTACGGGAGGCAGCAG-3’) and 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by an ABI Gene Amp® 9700 PCR thermocycler (ABI, CA, USA). The PCR reaction mixture included 4 μL 5× Fast Pfu buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... in QuantStudio 7 Flex (Applied Biosystems, ABI) machine ...
-
bioRxiv - Neuroscience 2021Quote: ... F Treatment with ABI (Sham+ABI and GDX+ABI pooled) reduced the number of overall errors ...
-
bioRxiv - Neuroscience 2021Quote: ... F Treatment with ABI (Sham+ABI and GDX+ABI pooled) reduced the number of overall errors ...
-
bioRxiv - Cancer Biology 2023Quote: ... qPCR was performed on an QuantStudio 7 instrument (ABI) using 2X Universal SYBR green fast mix (ABClonal) ...
-
bioRxiv - Bioengineering 2020Quote: ... The media were collected from the upper channel at different time points (0 h, 1 h and 2 h) and the fluorescence intensity was measured using microplate system (ABI Vii 7).
-
bioRxiv - Molecular Biology 2021Quote: ... The cDNA was further diluted by 1/3 and 1/10 in ROX350/HiDi and samples loaded onto capillary electrophoresis sequencers (ABI-3730) on capillary electrophoresis (CE ...
-
bioRxiv - Genetics 2022Quote: ... by QuantStudio 3 (ABI). The detailed method was followed by Iijima et al ...
-
bioRxiv - Neuroscience 2023Quote: ... and qRT-PCR analysis was run using the ViiaTM 7 Real-Time PCR System (ABI). Primer efficiencies were determined by standard dilution curve analysis ...
-
bioRxiv - Genetics 2020Quote: ... followed by PCR amplification (ncoa3CRISPR F: FAM-ATGAATGAGCAAGGCCACAT; ncoa3CRIPSR R: GGACTTGCTCCCATTTTAGG) and subjected to fragment length analysis (ABI 3500) to test gRNA efficiency (90% efficiency rate detected) ...
-
bioRxiv - Genomics 2020Quote: ... the purified DNA was quantified with ABI ViiA 7 and Power SYBR Green Master Mix (ABI 4368706) and normalized by genomic DNA ...
-
bioRxiv - Plant Biology 2021Quote: ... The qRT-PCR reaction system (ABI QuantStudio 3) included ...
-
bioRxiv - Microbiology 2019Quote: ... Real-time PCR was then performed using a QuantStudio 6 Flex System (ABI) according to the manufacturer’s standard protocol ...
-
bioRxiv - Microbiology 2021Quote: ... according to the manufacturer’s instructions and completed on QuantStudio 6 Flex system (ABI). RNA expression levels were determined through the ΔΔCt method and normalized with GAPDH or 18S as a housekeeping gene.
-
bioRxiv - Neuroscience 2022Quote: ... detector system (ABI Quant studio 5) and the SYBR Green detection protocol ...
-
bioRxiv - Genetics 2022Quote: ... and the data collection was performed on QuantStudioTM 6 Flex system(ABI, Life, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... employing the QuantStudio® 3 Real-Time PCR systems (ABI). qPCR primers are shown in Table S1.
-
bioRxiv - Genomics 2020Quote: The purified cDNA or dsDNA samples were assayed by quantitative PCR with ABI ViiA 7 and Power SYBR Green Master Mix (ABI 4368706) using custom designed primers (Additional file 3 ...
-
bioRxiv - Immunology 2019Quote: ... six samples from each run were separately derivatized with TMT 6-plex reagents (ABI, Framingham, MA) according to the instructions provided by the manufacturer ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... using a QuantStudio™ 7 Flex device and results were analyzed with QuantStudio™ Real-Time PCR software (both ABI, Waltham, MA, USA)
-
bioRxiv - Molecular Biology 2023Quote: ... The reaction was conducted on Applied Biosystems® QuantStudio 3 (ABI, USA) following the conditions ...
-
bioRxiv - Plant Biology 2023Quote: ... China) was used for quantitative real-time PCR in a Thermo Fisher system (ABI QuantStudio 6 Flex) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and real-time quantitative PCR (QuantStudio ™ 3 Real-Time PCR System, ABI, USA).
-
bioRxiv - Microbiology 2021Quote: ... Quantitative real-time PCR reactions were performed on an Applied Biosystems QuantStudio 6 Flex Real-Time PCR Instrument (ABI). Delta-delta-cycle threshold (ΔΔCT ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... Quantification of gene expression was measured by RT-qPCR on Quant Studio 6 Flex Real -Time PCR system (ABI). Target genes expression was calculated using the ∆∆Ct method and expression was normalized with GAPDH expression levels ...
-
bioRxiv - Developmental Biology 2022Quote: ... qPCR was run in 384-well plates on an Applied Biosystems QuantStudio 6 Flex Real-Time PCR System (ABI) and analyzed in Microsoft Excel.
-
bioRxiv - Microbiology 2020Quote: ... followed by 5 min on ice and then analyzed by ABI Prism 3730XL DNA analyzer (Applied Biosystems ...
-
bioRxiv - Genetics 2022Quote: ... The F-primer of each microsatellite was labeled with fluorescent dye (6-Fam, Vic, Ned or Pet) and the amplification products were read by ABI 3130xl Fluorescence Reader (Applied Biosystems).
-
bioRxiv - Plant Biology 2023Quote: ... by using the HieffTM qPCR SYBR Green Master Mix (Low Rox Plus, cat no. 11202ES08, Yeasen, Shanghai, China) on a QuantStudio 6 Flex PCR (ABI). The qPCR signals were normalized to those of the reference gene PST in pine trees ...
-
bioRxiv - Microbiology 2023Quote: ... was performed using SYBR Green Real-time PCR Master Mix (QPK-201, Toyobo) with the QuantStudio 6 Flex multicolor real-time PCR detection system (ABI). Relative mRNA levels were normalized to GAPDH levels and calculated using the 2-ΔΔCT method (Livak & Schmittgen ...
-
bioRxiv - Plant Biology 2024Quote: ... with Hieff™ qPCR SYBR Green Master Mix (Low Rox Plus, cat no. 11202ES08, Yeasen, Shanghai, China) on a QuantStudio 6 Flex PCR system (ABI). The qPCR signals were normalized to those of the reference gene PST in Pinus by applying the 2-ΔΔCT method (Fang et al. ...
-
bioRxiv - Physiology 2019Quote: ... Quantitative real-time PCR assays were performed under a Real-time PCR Detection System of QuantStudio™6 Flex (ABI, USA) in a 384-well plate format using SYBR Green PCR (TOYOBO ...
-
bioRxiv - Biochemistry 2019Quote: ... In some experiments we used 6-FAM-labeled DNA and resolved and quantified products using an Applied Biosystems DNA sequencer (ABI 3130xl). Control experiments using radiolabeled DNA established that the 6-FAM label did not alter the kinetics.
-
bioRxiv - Molecular Biology 2019Quote: qPCRs were carried out in a QuantStudio 5 System (ABI/Life Technologies) equipped with the QuantStudio TM Design and Analysis Software version 1.4.1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... We conducted qPCR on 384-well plates (ABI Quantstudio 5, Foster City, CA). For each sample ...
-
bioRxiv - Immunology 2021Quote: ... and levels of IFNG transcript are quantified by real-time qPCR (ABI QuantStudio 5) using the TaqMan Fast Advanced MasterMix (ABI ...
-
bioRxiv - Molecular Biology 2023Quote: Real-time PCR was performed as reported previously (Tan et al., 2019) using the QuantStudio 6 Flex Real-Time PCR System (ABI, Thermo Fisher, Shanghai, China) and Roche LightCycler® 480 (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT–qPCR of ame-miR-34 was conducted on a QuantStudio 3 fluorescent quantitative PCR system (ABI Company, USA). AmU6 (GenBank ID ...
-
bioRxiv - Biochemistry 2023Quote: ... before the cells were heated at 53°C for 3 min in a Veriti 96-well Thermal Cycler (ABI). Samples were subsequently rested at RT for 3 min ...
-
bioRxiv - Microbiology 2022Quote: ... using a 5 μL injector loop on a Tempo LC MALDI Spotting system (ABI-MDS/Sciex). Separation was over a 50 min solvent gradient from 2% ACN and 0.1% TFA (v/v ...
-
bioRxiv - Molecular Biology 2019Quote: ... The cycling conditions consisted of denaturation at 95°C for 3 min followed by 40 cycles of 95°C for 3 s and 60 or 63°C for 30 s (ABI 7500 instrument). At the end of the PCR amplification ...
-
bioRxiv - Physiology 2024Quote: ... PCR reactions were performed in a 96-well format on an ABI QuantStudio 3 using Fast SYBR Green Master Mix (ABI, cat. 4385612). β2-macroglobulin was used for normalization ...
-
bioRxiv - Pathology 2022Quote: ... Real-time PCR was carried out in an Applied Biosystems QuantStudio 5 Real-Time PCR System (ABI, Warrington, UK) with SYBR Green PCR master mix (Takara ...
-
bioRxiv - Microbiology 2021Quote: ... Gene-specific products were normalized to a group of 5 housekeeping genes (ACTB, B2M, GAPDH, HPRT1, RPLP0) and quantified using the comparative ΔΔCt method (ABI PRISM 7500 sequence detection system user guide) ...
-
bioRxiv - Microbiology 2020Quote: ... were selected for 16S rRNA gene PCR using universal primers (27F 5’-AGAGTTTGATCMTGGCTCAG-3’ and 1492R 5’-TACGGYTACCTTGTTACGACTT-3’) followed by sequencing at First Base Laboratories SdnBhd (Malaysia) using Applied Biosystems highest capacity-based genetic analyzer (ABI PRISM® 377 DNA Sequencer) platforms with the BigDye® Terminator v3.1 cycle sequencing kit chemistry (Masomian et al. ...
-
bioRxiv - Plant Biology 2019Quote: ... 25 µL samples were prepared by mixing 5 µL of gDNA sample with 12.5 µL of Sybr Green Mastermix (ABI, Carlsbad, California) along with primers and water ...
-
bioRxiv - Developmental Biology 2023Quote: ... Real-time PCR was performed by using a SYBR Premix Ex Taq kit (Q711-02, Vazyme) on the QuantStudio 5 Real-Time System (ABI, USA). The data were normalized against the levels of Rpl7 expression ...