Labshake search
Citations for American BioInnovations, :
1 - 50 of 90 citations for 6 Isoquinolinol 1 4 5 dimethoxy 2 5 6 6a 7 tetrahydro 1 2 10 trimethoxy 6 methyl 4H dibenzo de g quinolin 9 yl oxy phenyl methyl 1 2 3 4 tetrahydro 7 methoxy 2 methyl S R* R* 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... The media were collected from the upper channel at different time points (0 h, 1 h and 2 h) and the fluorescence intensity was measured using microplate system (ABI Vii 7).
-
bioRxiv - Genetics 2019Quote: ... and then 1–2 μg RNA was reverse-transcribed by random hexamer priming and Multi Scribe reverse transcriptase (ABI). Amplification was performed using the primers ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 1-10 ng template in 9 μl Nuclease-free water were added to 10.0 μL of 2× TaqMan® Universal PCR master mix (ABI/Life technologies, USA) and 1.0 μL of a 20× combined primers and probes mix (ABI/Life Technologies ...
-
bioRxiv - Microbiology 2019Quote: ... Real-time PCR was then performed using a QuantStudio 6 Flex System (ABI) according to the manufacturer’s standard protocol ...
-
bioRxiv - Microbiology 2021Quote: ... according to the manufacturer’s instructions and completed on QuantStudio 6 Flex system (ABI). RNA expression levels were determined through the ΔΔCt method and normalized with GAPDH or 18S as a housekeeping gene.
-
bioRxiv - Neuroscience 2023Quote: ... was used to perform qPCR using 2× Takara TB Green Mastermix (ABI), and the respective specific primers are shown in Table 1 ...
-
bioRxiv - Neuroscience 2022Quote: ... in QuantStudio 7 Flex (Applied Biosystems, ABI) machine ...
-
bioRxiv - Genetics 2022Quote: ... and the data collection was performed on QuantStudioTM 6 Flex system(ABI, Life, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cDNA was further diluted by 1/3 and 1/10 in ROX350/HiDi and samples loaded onto capillary electrophoresis sequencers (ABI-3730) on capillary electrophoresis (CE ...
-
bioRxiv - Cell Biology 2021Quote: ... PCSK9 mRNA expression was assessed by real-time PCR using PCSK9 primer sets 5’-TGTCTTTGCCCAGAGCATC-3’ and 5’-GTCACTCTGTATGCTGGTGTC-3 (Integrated DNA Technologies) and SYBR Select Master Mix (ThermoFisher, ABI 4472908).
-
bioRxiv - Developmental Biology 2022Quote: ... Gene expression was conducted using the 2^-deltadeltaCT method using ViiA qPCR system (ABI) following MIQE guidelines [17] ...
-
Quantitative three-dimensional nondestructive imaging of whole anaerobic ammonium-oxidizing bacteriabioRxiv - Cell Biology 2019Quote: ... The V3-V4 regions of the anammox 16S rRNA gene were amplified with the primer 338F (5’-ACTCCTACGGGAGGCAGCAG-3’) and the primer 806R (5’-GGACTACHVGGGTWTCTAAT-3’) using polymerase chain reaction (PCR) (ABI GeneAmp 9700). The PCR program was as follows ...
-
bioRxiv - Immunology 2019Quote: ... six samples from each run were separately derivatized with TMT 6-plex reagents (ABI, Framingham, MA) according to the instructions provided by the manufacturer ...
-
bioRxiv - Genetics 2021Quote: ... the QTR locus in TCERG1 was amplified by PCR using a fluorescently-labelled forward (5’-FAM-AACTGACACCTATGCTTG-3’) and unlabelled reverse (5’-GTTGAAGTGGATACTGCA-3’) primer before sizing by capillary electrophoresis (ABI 3730 genetic analyzer) and Genescan against a LIZ600 ladder of size standards (Thermofisher) ...
-
bioRxiv - Immunology 2022Quote: ... The hypervariable region V3-V4 of the bacterial 16S rRNA gene was amplified with primer pairs 338F (5’-ACTCCTACGGGAGGCAGCAG-3’) and 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by an ABI Gene Amp® 9700 PCR thermocycler (ABI, CA, USA). The PCR reaction mixture included 4 μL 5× Fast Pfu buffer ...
-
bioRxiv - Bioengineering 2021Quote: ... The images were obtained with a system developed in-house consisting of two red LED lamps (610-630 nm, GR-PAR38-12W-R-1, ABI, Indianapolis, IN) for excitation ...
-
bioRxiv - Cancer Biology 2023Quote: ... qPCR was performed on an QuantStudio 7 instrument (ABI) using 2X Universal SYBR green fast mix (ABClonal) ...
-
bioRxiv - Plant Biology 2023Quote: ... China) was used for quantitative real-time PCR in a Thermo Fisher system (ABI QuantStudio 6 Flex) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... 95°C for 10 min, 40 cycles of 15 s at 95°C, and 60°C for 1 min; ABI PRISM 7000 Sequence Detection System ...
-
bioRxiv - Immunology 2020Quote: ... the relative standard curve method (see Applied Biosystems User Bulletin #2 https://www.gu.se/digitalAssets/1125/1125331_ABI_Guide_Relative_Quantification_using_realtime_PCR.pdf ...
-
bioRxiv - Immunology 2020Quote: ... the relative standard curve method (see Applied Biosystems User Bulletin #2 https://www.gu.se/digitalAssets/1125/1125331_ABI_Guide_Relative_Quantification_using_realtime_PCR.pdf ...
-
bioRxiv - Neuroscience 2022Quote: Aliquots (2 μl) of samples were used for MALDI-TOF/TOF MS (ABI 4800 model, Applied Biosystems) measurements ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative real-time PCR reactions were performed on an Applied Biosystems QuantStudio 6 Flex Real-Time PCR Instrument (ABI). Delta-delta-cycle threshold (ΔΔCT ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... Quantification of gene expression was measured by RT-qPCR on Quant Studio 6 Flex Real -Time PCR system (ABI). Target genes expression was calculated using the ∆∆Ct method and expression was normalized with GAPDH expression levels ...
-
bioRxiv - Developmental Biology 2022Quote: ... qPCR was run in 384-well plates on an Applied Biosystems QuantStudio 6 Flex Real-Time PCR System (ABI) and analyzed in Microsoft Excel.
-
bioRxiv - Neuroscience 2021Quote: ... The protocol followed the manufacturer’s recommendations with the exception of using 2 μl for each RT primer (ABI) in a 10 μl total reaction volume (i.e. ...
-
bioRxiv - Immunology 2023Quote: ... 2 μl of cDNA were added to 23 μl of PCR mixture containing 2xSYBR Green Master Mix (ABI) and 0.2 μM of forward and reverse primers ...
-
bioRxiv - Genetics 2022Quote: ... The F-primer of each microsatellite was labeled with fluorescent dye (6-Fam, Vic, Ned or Pet) and the amplification products were read by ABI 3130xl Fluorescence Reader (Applied Biosystems).
-
bioRxiv - Plant Biology 2023Quote: ... by using the HieffTM qPCR SYBR Green Master Mix (Low Rox Plus, cat no. 11202ES08, Yeasen, Shanghai, China) on a QuantStudio 6 Flex PCR (ABI). The qPCR signals were normalized to those of the reference gene PST in pine trees ...
-
bioRxiv - Microbiology 2023Quote: ... was performed using SYBR Green Real-time PCR Master Mix (QPK-201, Toyobo) with the QuantStudio 6 Flex multicolor real-time PCR detection system (ABI). Relative mRNA levels were normalized to GAPDH levels and calculated using the 2-ΔΔCT method (Livak & Schmittgen ...
-
bioRxiv - Plant Biology 2024Quote: ... with Hieff™ qPCR SYBR Green Master Mix (Low Rox Plus, cat no. 11202ES08, Yeasen, Shanghai, China) on a QuantStudio 6 Flex PCR system (ABI). The qPCR signals were normalized to those of the reference gene PST in Pinus by applying the 2-ΔΔCT method (Fang et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Each ChIP sample and a range of dilutions of the corresponding input sample (0.01 – 2% input) were quantitatively analyzed with gene-specific primers using the StepOnePlus System (ABI) and SYBR qPCR Powermix (ABI).
-
bioRxiv - Neuroscience 2021Quote: ... Each ChIP sample and a range of dilutions of the corresponding input sample (0.01 – 2% input) were quantitatively analyzed with gene-specific primers using the StepOnePlus System (ABI) and SYBR qPCR Powermix (ABI) ...
-
bioRxiv - Neuroscience 2020Quote: ... Each ChIP sample and a range of dilutions of the corresponding input sample (0.01 – 2% input) were quantitatively analyzed with gene-specific primers using the 7500 detection system (ABI) and SYBR qPCR Premix (Clontech) ...
-
bioRxiv - Physiology 2019Quote: ... Quantitative real-time PCR assays were performed under a Real-time PCR Detection System of QuantStudio™6 Flex (ABI, USA) in a 384-well plate format using SYBR Green PCR (TOYOBO ...
-
bioRxiv - Biochemistry 2019Quote: ... In some experiments we used 6-FAM-labeled DNA and resolved and quantified products using an Applied Biosystems DNA sequencer (ABI 3130xl). Control experiments using radiolabeled DNA established that the 6-FAM label did not alter the kinetics.
-
bioRxiv - Neuroscience 2021Quote: ... Synthesized cDNA was used for qPCR by 2× ChamQTM Universal SYBR qPCR Master Mix (Vazyme) on StepOnePlusTM Real-Time PCR System (ABI) or BioRad CFX96 Touch Real-Time PCR system ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA was generated from 2 μg RNA in 20 μl reactions using High-Capacity Reverse Transcriptase kit (ABI, Thermo Fisher). Real-time quantitative PCR (RT-qPCR ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2 μl diluted cDNA in Optical 8-Tube Strip using the Applied Biosystems 7300 Real-Time PCR Instrument (ABI, USA). The conditions for real-time PCR were as follows ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were verified by 2% agarose electrophoresis gel and subjected to sequencing by using a 3730XL DNA Analyzer (ABI, USA).
-
bioRxiv - Neuroscience 2023Quote: ... and qRT-PCR analysis was run using the ViiaTM 7 Real-Time PCR System (ABI). Primer efficiencies were determined by standard dilution curve analysis ...
-
bioRxiv - Molecular Biology 2023Quote: Real-time PCR was performed as reported previously (Tan et al., 2019) using the QuantStudio 6 Flex Real-Time PCR System (ABI, Thermo Fisher, Shanghai, China) and Roche LightCycler® 480 (Roche ...
-
bioRxiv - Genomics 2020Quote: ... the purified DNA was quantified with ABI ViiA 7 and Power SYBR Green Master Mix (ABI 4368706) and normalized by genomic DNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... The cycling conditions consisted of denaturation at 95°C for 3 min followed by 40 cycles of 95°C for 3 s and 60 or 63°C for 30 s (ABI 7500 instrument). At the end of the PCR amplification ...
-
bioRxiv - Neuroscience 2022Quote: ... detector system (ABI Quant studio 5) and the SYBR Green detection protocol ...
-
bioRxiv - Genomics 2020Quote: ... AFP4/TMAC2 (ABI FIVE BINDING PROTEIN 4, AT3G02140), DOG1 (AT5G45830 ...
-
bioRxiv - Genomics 2020Quote: The purified cDNA or dsDNA samples were assayed by quantitative PCR with ABI ViiA 7 and Power SYBR Green Master Mix (ABI 4368706) using custom designed primers (Additional file 3 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... using a QuantStudio™ 7 Flex device and results were analyzed with QuantStudio™ Real-Time PCR software (both ABI, Waltham, MA, USA)
-
bioRxiv - Genetics 2020Quote: ... followed by PCR amplification (ncoa3CRISPR F: FAM-ATGAATGAGCAAGGCCACAT; ncoa3CRIPSR R: GGACTTGCTCCCATTTTAGG) and subjected to fragment length analysis (ABI 3500) to test gRNA efficiency (90% efficiency rate detected) ...
-
bioRxiv - Neuroscience 2021Quote: All 4 groups (Sham+Vehicle, Sham+ABI, GDX+Vehicle, GDX+ABI) were habituated for 1 week to 1 g Vehicle ...